Mercurial > repos > xilinxu > xilinxu
comparison fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml @ 3:997f5136985f draft default tip
Uploaded
| author | xilinxu |
|---|---|
| date | Thu, 14 Aug 2014 04:52:17 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| 2:dfe9332138cf | 3:997f5136985f |
|---|---|
| 1 <tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA"> | |
| 2 <description>converter</description> | |
| 3 <command>gunzip -cf $input | fastq_to_fasta $GZIPOUT $SKIPN $RENAMESEQ -o $output -v </command> | |
| 4 | |
| 5 <inputs> | |
| 6 <param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" /> | |
| 7 | |
| 8 <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases "> | |
| 9 <option value="">yes</option> | |
| 10 <option value="-n">no</option> | |
| 11 </param> | |
| 12 | |
| 13 <param name="GZIPOUT" type="select" label="Compress output file (using GZIP) "> | |
| 14 <option value="-z">yes</option> | |
| 15 <option value="">no</option> | |
| 16 </param> | |
| 17 | |
| 18 <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)"> | |
| 19 <option value="-r">yes</option> | |
| 20 <option value="">no</option> | |
| 21 </param> | |
| 22 | |
| 23 </inputs> | |
| 24 | |
| 25 <tests> | |
| 26 <test> | |
| 27 <!-- FASTQ-To-FASTA, keep N, don't rename --> | |
| 28 <param name="input" value="fastq_to_fasta1.fastq" /> | |
| 29 <param name="SKIPN" value=""/> | |
| 30 <param name="GZIPOUT" value=""/> | |
| 31 <param name="RENAMESEQ" value=""/> | |
| 32 <output name="output" file="fastq_to_fasta1a.out" /> | |
| 33 </test> | |
| 34 <test> | |
| 35 <!-- FASTQ-To-FASTA, discard N, rename --> | |
| 36 <param name="input" value="fastq_to_fasta1.fastq" /> | |
| 37 <param name="SKIPN" value="no"/> | |
| 38 <param name="GZIPOUT" value=""/> | |
| 39 <param name="RENAMESEQ" value="yes"/> | |
| 40 <output name="output" file="fastq_to_fasta1b.out" /> | |
| 41 </test> | |
| 42 </tests> | |
| 43 | |
| 44 <outputs> | |
| 45 <data format="fasta" name="output" metadata_source="input" label="$input.tag FASTA" /> | |
| 46 </outputs> | |
| 47 | |
| 48 <help> | |
| 49 | |
| 50 **What it does** | |
| 51 | |
| 52 This tool converts data from Solexa format to FASTA format (scroll down for format description). | |
| 53 | |
| 54 -------- | |
| 55 | |
| 56 **Example** | |
| 57 | |
| 58 The following data in Solexa-FASTQ format:: | |
| 59 | |
| 60 @CSHL_4_FC042GAMMII_2_1_517_596 | |
| 61 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
| 62 +CSHL_4_FC042GAMMII_2_1_517_596 | |
| 63 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 | |
| 64 | |
| 65 Will be converted to FASTA (with 'rename sequence names' = NO):: | |
| 66 | |
| 67 >CSHL_4_FC042GAMMII_2_1_517_596 | |
| 68 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
| 69 | |
| 70 Will be converted to FASTA (with 'rename sequence names' = YES):: | |
| 71 | |
| 72 >1 | |
| 73 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT | |
| 74 | |
| 75 </help> | |
| 76 </tool> | |
| 77 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |