view fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml @ 3:997f5136985f draft default tip

Uploaded
author xilinxu
date Thu, 14 Aug 2014 04:52:17 -0400
parents
children
line wrap: on
line source

<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
	<description>converter</description>
	<command>gunzip -cf $input | fastq_to_fasta $GZIPOUT $SKIPN $RENAMESEQ -o $output -v </command>

	<inputs>
		<param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" />

		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
			<option value="">yes</option>
			<option value="-n">no</option>
		</param>

		<param name="GZIPOUT" type="select" label="Compress output file (using GZIP) ">
			<option value="-z">yes</option>
			<option value="">no</option>
		</param>

		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
			<option value="-r">yes</option>
			<option value="">no</option>
		</param>

	</inputs>

	<tests>
		<test>
			<!-- FASTQ-To-FASTA, keep N, don't rename -->
			<param name="input" value="fastq_to_fasta1.fastq" />
			<param name="SKIPN" value=""/>
			<param name="GZIPOUT" value=""/>
			<param name="RENAMESEQ" value=""/>
			<output name="output" file="fastq_to_fasta1a.out" />
		</test>
		<test>
			<!-- FASTQ-To-FASTA, discard N, rename -->
			<param name="input" value="fastq_to_fasta1.fastq" />
			<param name="SKIPN" value="no"/>
			<param name="GZIPOUT" value=""/>
			<param name="RENAMESEQ" value="yes"/>
			<output name="output" file="fastq_to_fasta1b.out" />
		</test>
	</tests>

	<outputs>
		<data format="fasta" name="output" metadata_source="input" label="$input.tag FASTA" />
	</outputs>

<help>

**What it does**

This tool converts data from Solexa format to FASTA format (scroll down for format description).

--------

**Example**

The following data in Solexa-FASTQ format::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
  
Will be converted to FASTA (with 'rename sequence names' = NO)::

    >CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
Will be converted to FASTA (with 'rename sequence names' = YES)::

    >1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
</help>
</tool>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->