Mercurial > repos > xilinxu > xilinxu
view fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_clipper.xml @ 3:997f5136985f draft default tip
Uploaded
author | xilinxu |
---|---|
date | Thu, 14 Aug 2014 04:52:17 -0400 |
parents | |
children |
line wrap: on
line source
<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" > <description>adapter sequences</description> <command> zcat -f $input | fastx_clipper -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS </command> <inputs> <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" /> <param name="maxmismatches" size="4" type="integer" value="2"> <label>Maximum number of mismatches allowed (when matching the adapter sequence)</label> </param> <param name="minlength" size="4" type="integer" value="15"> <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label> </param> <conditional name="clip_source"> <param name="clip_source_list" type="select" label="Source"> <option value="prebuilt" selected="true">Standard (select from the list below)</option> <option value="user">Enter custom sequence</option> </param> <when value="user"> <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> </when> <when value="prebuilt"> <param name="clip_sequence" type="select" label="Choose Adapter"> <options from_file="fastx_clipper_sequences.txt"> <column name="name" index="1"/> <column name="value" index="0"/> </options> </param> </when> </conditional> <param name="keepdelta" size="2" type="integer" value="0"> <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> </param> <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> <option value="">Yes</option> <option value="-n">No</option> </param> <param name="DISCARD_OPTIONS" type="select" label="Output options"> <option value="-c">Output only clipped seqeunces (i.e. sequences which contained the adapter)</option> <option value="-C">Output only non-clipped seqeunces (i.e. sequences which did not contained the adapter)</option> <option value="">Output both clipped and non-clipped sequences</option> </param> </inputs> <tests> <test> <!-- Clip a FASTQ file --> <param name="input" value="fastx_clipper1.fastq" /> <param name="maxmismatches" value="2" /> <param name="minlength" value="15" /> <param name="clip_source.clip_source_list" value="user" /> <param name="clip_source.clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> <param name="keepdelta" value="0" /> <param name="KEEP_N" value="-n" /> <param name="DISCARD_OPTIONS" value="-c" /> <output name="output" file="fastx_clipper1a.out" /> </test> </tests> <outputs> <data format="input" name="output" metadata_source="input" /> </outputs> <help> **What it does** This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. -------- **Clipping Illustration:** .. image:: ./static/fastx_icons/fastx_clipper_illustration.png **Clipping Example:** .. image:: ./static/fastx_icons/fastx_clipper_example.png **In the above example:** * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). </help> </tool>