Mercurial > repos > xuebing > sharplab_seq_motif
changeset 12:7b8a5b55ee15
Deleted selected files
author | xuebing |
---|---|
date | Fri, 16 Mar 2012 16:11:05 -0400 (2012-03-16) |
parents | 92eac44fe40d |
children | 5a93fe53194d |
files | mytools/match.xml |
diffstat | 1 files changed, 0 insertions(+), 54 deletions(-) [+] |
line wrap: on
line diff
--- a/mytools/match.xml Fri Mar 16 15:27:31 2012 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,54 +0,0 @@ -<tool id="match" name="match"> - <description>find short motif occurrences</description> - <command> match $motif $seq $output $nmismatch $rc $bed > $log</command> - <inputs> - - <param name="motif" type="data" format="fasta" label="Search occurances of the following motifs" help="one or multiple sequences, FASTA format"/> - <param name="seq" type="data" format="fasta" label="in sequences" help="one or multiple sequences, FASTA format"/> - <param name="nmismatch" size="10" type="integer" value="0" label="number of mismatches allowed"/> - <param name="rc" label="Do not score the reverse complement DNA strand. Both strands are scored by default" type="boolean" truevalue="norc" falsevalue="rc" checked="False"/> - <param name="bed" label="output BED format" help="Default is tabular file (see example below). Please only check this if your sequence identifier looks like: hg18_chr6_122208322_122209078_+ (true for galaxy tool extracted sequences)" type="boolean" truevalue="bed" falsevalue="nobed" checked="True"/> - </inputs> - <outputs> - <data format="log" name="log" label="${tool.name} on ${on_string} (log)"/> - <data format="bed" name="output" label="${tool.name} on ${on_string} (bed)"/> - </outputs> - <help> - -**What it does** - -This tool searches occurrences of a short nucleotide seuqences (allowing mismatches) in a set of longer sequences. - -Example motif file:: - - >motif1 - CAGGTAAGT - >motif2 - GTTTGGGGGCC - -Example sequence file:: - - >hg18_chr6_122208322_122209078_+ - CGTCGTAGCTACTAGCTACGTACGTACGTAGCTAGCATGCATGCTACGTA - CGTAGCTAGCTAAAAAAAAAAAAAAACTGCGGCTAGCTAGCTAGCTACGT - CGATCGTAGCTAC... - >hg18_chr6_1208322_122209023_+ - CGATGCTAGCTAGCTAGCTACGTAGCTAGCTAGTCGATGCTAGCTAGCTA - ATGCTAGCTAGC.... - -Output (bed):: - - chr11 72790893 72790902 ACTTAACTG 1 - antisense 5ss,G4T:CAGTTAAGT-rc hg18_chr11_72790846_72791902_+ 47 - chr11 72791880 72791889 CAGGTAAGA 1 + sense 5ss,T9A:CAGGTAAGA hg18_chr11_72790846_72791902_+ 1034 - - -Output (tab):: - - Tmod4 802 5ss:CAGGTAAGT-rc ACTTACCTG - Atp7b 77 5ss:CAGGTAAGT CAGGTAAGT - Fnta 665 5ss:CAGGTAAGT CAGGTAAGT - - - - </help> -</tool>