Mercurial > repos > xuebing > sharplabtool

comparison tools/rgenetics/rgFastQC.xml @ 0:9071e359b9a3

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author xuebing
date Fri, 09 Mar 2012 19:37:19 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:9071e359b9a3
1 <tool name="Fastqc: Fastqc QC" id="fastqc" version="0.1">
2 <description>using FastQC from Babraham</description>
3 <command interpreter="python">
4 rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc
5 #if $contaminants.dataset and str($contaminants) > ''
6 -c "$contaminants"
7 #end if
8 </command>
9 <requirements>
10 <requirement type="package">FastQC</requirement>
11 </requirements>
12 <inputs>
13 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
14 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" />
15 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
16 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
17 </inputs>
18 <outputs>
19 <data format="html" name="html_file" label="${out_prefix}.html" />
20 </outputs>
21 <tests>
22 <test>
23 <param name="input_file" value="1000gsample.fastq" />
24 <param name="out_prefix" value="fastqc_out" />
25 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
26 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
27 </test>
28 </tests>
29 <help>
30
31 .. class:: infomark
32
33 **Purpose**
34
35 FastQC aims to provide a simple way to do some quality control checks on raw
36 sequence data coming from high throughput sequencing pipelines.
37 It provides a modular set of analyses which you can use to give a quick
38 impression of whether your data has any problems of
39 which you should be aware before doing any further analysis.
40
41 The main functions of FastQC are:
42
43 - Import of data from BAM, SAM or FastQ files (any variant)
44 - Providing a quick overview to tell you in which areas there may be problems
45 - Summary graphs and tables to quickly assess your data
46 - Export of results to an HTML based permanent report
47 - Offline operation to allow automated generation of reports without running the interactive application
48
49 **FastQC documentation**
50
51 This is a Galaxy interface to the external package FastQC_.
52 Specific documentation on FastQC can be found on that site.
53 FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
54
55 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
56 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
57
58 The contaminants file parameter was borrowed from the independently developed
59 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
60
61 -----
62
63 .. class:: infomark
64
65 **Inputs and outputs**
66
67 This wrapper will accept any fastq file as well as sam or bam as the primary file to check.
68 It will also take an optional file containing a list of contaminants information, in the form of
69 a tab-delimited file with 2 columns, name and sequence.
70
71 The tool produces a single HTML output file that contains all of the results, including the following:
72
73 - Basic Statistics
74 - Per base sequence quality
75 - Per sequence quality scores
76 - Per base sequence content
77 - Per base GC content
78 - Per sequence GC content
79 - Per base N content
80 - Sequence Length Distribution
81 - Sequence Duplication Levels
82 - Overrepresented sequences
83 - Kmer Content
84
85 All except Basic Statistics and Overrepresented sequences are plots.
86
87 </help>
88 </tool>