Mercurial > repos > xuebing > sharplabtool
view tools/rgenetics/rgFastQC.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line source
<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.1"> <description>using FastQC from Babraham</description> <command interpreter="python"> rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc #if $contaminants.dataset and str($contaminants) > '' -c "$contaminants" #end if </command> <requirements> <requirement type="package">FastQC</requirement> </requirements> <inputs> <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" /> <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> </inputs> <outputs> <data format="html" name="html_file" label="${out_prefix}.html" /> </outputs> <tests> <test> <param name="input_file" value="1000gsample.fastq" /> <param name="out_prefix" value="fastqc_out" /> <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> </test> </tests> <help> .. class:: infomark **Purpose** FastQC aims to provide a simple way to do some quality control checks on raw sequence data coming from high throughput sequencing pipelines. It provides a modular set of analyses which you can use to give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis. The main functions of FastQC are: - Import of data from BAM, SAM or FastQ files (any variant) - Providing a quick overview to tell you in which areas there may be problems - Summary graphs and tables to quickly assess your data - Export of results to an HTML based permanent report - Offline operation to allow automated generation of reports without running the interactive application **FastQC documentation** This is a Galaxy interface to the external package FastQC_. Specific documentation on FastQC can be found on that site. FastQC incorporates the Picard-tools_ libraries for sam/bam processing. .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ .. _Picard-tools: http://picard.sourceforge.net/index.shtml The contaminants file parameter was borrowed from the independently developed fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. ----- .. class:: infomark **Inputs and outputs** This wrapper will accept any fastq file as well as sam or bam as the primary file to check. It will also take an optional file containing a list of contaminants information, in the form of a tab-delimited file with 2 columns, name and sequence. The tool produces a single HTML output file that contains all of the results, including the following: - Basic Statistics - Per base sequence quality - Per sequence quality scores - Per base sequence content - Per base GC content - Per sequence GC content - Per base N content - Sequence Length Distribution - Sequence Duplication Levels - Overrepresented sequences - Kmer Content All except Basic Statistics and Overrepresented sequences are plots. </help> </tool>