|
0
|
1 <tool id="glimmerhmm_predict" name="GlimmerHMM" version="0.1">
|
|
|
2 <description>Predict ORFs in eukaryotic genomes</description>
|
|
|
3 <command>glimmerhmm
|
|
|
4 $input /home/galaxy/lib/glimmer_trainings/train_crypto
|
|
|
5 -o $output
|
|
|
6 -g
|
|
|
7 $svm_splice_prediction
|
|
|
8 $partial_gene
|
|
|
9 #if str($top_n_predictions) != "-1":
|
|
|
10 -n $top_n_predictions
|
|
|
11 #end if
|
|
|
12 2> /dev/null</command>
|
|
|
13 <inputs>
|
|
|
14 <param name="input" type="data" format="fasta" label="Genome Sequence"/>
|
|
|
15 <param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" />
|
|
|
16 <param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" />
|
|
|
17 <param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/>
|
|
|
18 </inputs>
|
|
|
19 <outputs>
|
|
|
20 <data format="tabular" name="output">
|
|
|
21 <change_format>
|
|
|
22 <when input="gff" value="-g" format="gff" />
|
|
|
23 </change_format>
|
|
|
24 </data>
|
|
|
25 </outputs>
|
|
|
26 <help>
|
|
|
27
|
|
|
28 **What it does**
|
|
|
29
|
|
|
30 GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
|
|
|
31 Although the gene finder conforms to the overall mathematical framework of a GHMM,
|
|
|
32 additionally it incorporates splice site models adapted from the GeneSplicer program and a
|
|
|
33 decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
|
|
|
34 coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
|
|
|
35 intergenic regions, and four types of exons (initial, internal, final, and single).
|
|
|
36 A basic user manual can be consulted here.
|
|
|
37
|
|
|
38 -----
|
|
|
39
|
|
|
40 **Example**
|
|
|
41
|
|
|
42 Suppose you have the following DNA formatted sequences::
|
|
|
43
|
|
|
44 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
|
|
|
45 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
|
|
|
46 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
|
|
|
47 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
|
|
|
48 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
|
|
|
49 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
|
|
|
50
|
|
|
51 Running this tool will produce this::
|
|
|
52
|
|
|
53 ##gff-version 3
|
|
|
54 ##sequence-region ConsensusfromCH236920mapping 1 4148552
|
|
|
55 ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
|
|
|
56 ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1;
|
|
|
57 ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
|
|
|
58 ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1;
|
|
|
59 ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2;
|
|
|
60 ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3
|
|
|
61
|
|
|
62
|
|
|
63
|
|
|
64 </help>
|
|
|
65 </tool>
|
