--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/glimmerHMM/glimmerhmm_predict.xml	Wed Jan 11 09:58:35 2012 -0500
@@ -0,0 +1,65 @@
+<tool id="glimmerhmm_predict" name="GlimmerHMM" version="0.1">
+	<description>Predict ORFs in eukaryotic genomes</description>
+	<command>glimmerhmm 
+	    $input /home/galaxy/lib/glimmer_trainings/train_crypto 
+	    -o $output 
+	    -g 
+	    $svm_splice_prediction 
+	    $partial_gene
+	    #if str($top_n_predictions) != "-1":
+	        -n $top_n_predictions
+        #end if
+	    2> /dev/null</command>
+	<inputs>
+		<param name="input" type="data" format="fasta" label="Genome Sequence"/>
+		<param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" />
+		<param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" />
+		<param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/>
+	</inputs>
+	<outputs>
+        <data format="tabular" name="output">
+            <change_format>
+                <when input="gff" value="-g" format="gff" />
+            </change_format>
+        </data>
+    </outputs>
+	<help>
+
+**What it does**
+
+GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM).
+Although the gene finder conforms to the overall mathematical framework of a GHMM,
+additionally it incorporates splice site models adapted from the GeneSplicer program and a
+decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the
+coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase,
+intergenic regions, and four types of exons (initial, internal, final, and single).
+A basic user manual can be consulted here.
+
+-----	
+
+**Example**
+
+Suppose you have the following DNA formatted sequences::
+
+    >SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
+    cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+    ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+    cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+    cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+    ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+
+Running this tool will produce this::
+
+    ##gff-version 3
+    ##sequence-region ConsensusfromCH236920mapping 1 4148552
+    ConsensusfromCH236920mapping  GlimmerHMM  mRNA  1       122     .   +   .   ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
+    ConsensusfromCH236920mapping  GlimmerHMM  CDS   1       122     .   +   0   ID=ConsensusfromCH236920mapping.cds1.1;
+    ConsensusfromCH236920mapping  GlimmerHMM  mRNA  14066   15205   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
+    ConsensusfromCH236920mapping  GlimmerHMM  CDS   14066   15034   .   -   0   ID=ConsensusfromCH236920mapping.cds2.1;
+    ConsensusfromCH236920mapping  GlimmerHMM  CDS   15137   15205   .   -   0   ID=ConsensusfromCH236920mapping.cds2.2;
+    ConsensusfromCH236920mapping  GlimmerHMM  mRNA  19910   24210   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3
+
+
+
+	</help>
+</tool>