Mercurial > repos > bjoern-gruening > glimmer_hmm
comparison glimmerHMM/glimmerhmm_predict.xml @ 0:0a15677c6668 default tip
Uploaded
| author | bjoern-gruening |
|---|---|
| date | Wed, 11 Jan 2012 09:58:35 -0500 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:0a15677c6668 |
|---|---|
| 1 <tool id="glimmerhmm_predict" name="GlimmerHMM" version="0.1"> | |
| 2 <description>Predict ORFs in eukaryotic genomes</description> | |
| 3 <command>glimmerhmm | |
| 4 $input /home/galaxy/lib/glimmer_trainings/train_crypto | |
| 5 -o $output | |
| 6 -g | |
| 7 $svm_splice_prediction | |
| 8 $partial_gene | |
| 9 #if str($top_n_predictions) != "-1": | |
| 10 -n $top_n_predictions | |
| 11 #end if | |
| 12 2> /dev/null</command> | |
| 13 <inputs> | |
| 14 <param name="input" type="data" format="fasta" label="Genome Sequence"/> | |
| 15 <param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" /> | |
| 16 <param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" /> | |
| 17 <param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/> | |
| 18 </inputs> | |
| 19 <outputs> | |
| 20 <data format="tabular" name="output"> | |
| 21 <change_format> | |
| 22 <when input="gff" value="-g" format="gff" /> | |
| 23 </change_format> | |
| 24 </data> | |
| 25 </outputs> | |
| 26 <help> | |
| 27 | |
| 28 **What it does** | |
| 29 | |
| 30 GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM). | |
| 31 Although the gene finder conforms to the overall mathematical framework of a GHMM, | |
| 32 additionally it incorporates splice site models adapted from the GeneSplicer program and a | |
| 33 decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the | |
| 34 coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase, | |
| 35 intergenic regions, and four types of exons (initial, internal, final, and single). | |
| 36 A basic user manual can be consulted here. | |
| 37 | |
| 38 ----- | |
| 39 | |
| 40 **Example** | |
| 41 | |
| 42 Suppose you have the following DNA formatted sequences:: | |
| 43 | |
| 44 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; | |
| 45 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg | |
| 46 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag | |
| 47 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc | |
| 48 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc | |
| 49 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg | |
| 50 | |
| 51 Running this tool will produce this:: | |
| 52 | |
| 53 ##gff-version 3 | |
| 54 ##sequence-region ConsensusfromCH236920mapping 1 4148552 | |
| 55 ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1 | |
| 56 ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1; | |
| 57 ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2 | |
| 58 ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1; | |
| 59 ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2; | |
| 60 ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3 | |
| 61 | |
| 62 | |
| 63 | |
| 64 </help> | |
| 65 </tool> |