Mercurial > repos > fabio > sbtas_se

comparison query.xml @ 12:039e8e1e8b1f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded 20180201
author fabio
date Thu, 01 Feb 2018 16:23:17 -0500
parents 027f2e9d4a25
children e780b47013df
comparison
equal deleted inserted replaced
11:0d0f7080b55c 12:039e8e1e8b1f
32 <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> 32 <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input">
33 <option value="0" selected="true">By file</option> 33 <option value="0" selected="true">By file</option>
34 <option value="1">By manually inserted text</option> 34 <option value="1">By manually inserted text</option>
35 </param> 35 </param>
36 <when value="0"> 36 <when value="0">
37 <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." /> 37 <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
38 </when> 38 </when>
39 <when value="1"> 39 <when value="1">
40 <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." /> 40 <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
41 </when> 41 </when>
42 </conditional> 42 </conditional>
43 <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." /> 43 <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
44 </inputs> 44 </inputs>
45 <outputs> 45 <outputs>
46 <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection"> 46 <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
47 <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="tabular" /> 47 <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
48 </collection> 48 </collection>
49 </outputs> 49 </outputs>
50 50
51 <help><![CDATA[ 51 <help><![CDATA[
52 The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available 52 The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available
53 sequenced samples which express a transcript of interest. 53 sequenced samples which express a transcript of interest.
54 54
55 ---- 55 ----
56 56
57 **Example** 57 The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
58
59 The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
60 in a tab delimited format:: 58 in a tab delimited format::
61 59
62 id0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA 60 id0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
63 id1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT 61 id1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
64 ... 62 ...