--- a/query.xml	Wed Jan 31 17:29:13 2018 -0500
+++ b/query.xml	Thu Feb 01 16:23:17 2018 -0500
@@ -34,17 +34,17 @@
                 <option value="1">By manually inserted text</option>
             </param>
             <when value="0">
-                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
             <when value="1">
-                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
         </conditional>            
         <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
     </inputs>
     <outputs>
         <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
-            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="tabular" />
+            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
         </collection>
     </outputs>
 
@@ -54,9 +54,7 @@
 
 ----
 
-**Example**
-
-The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line,
+The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
 in a tab delimited format::
     
     id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA