Mercurial > repos > iuc > lorikeet_spoligotype
changeset 0:d35cc8e07d00 draft
planemo upload for repository https://github.com/AbeelLab/lorikeet commit 01d9bfef91bbdfbdaa31c3fc023504181132c001
| author | iuc |
|---|---|
| date | Tue, 08 May 2018 04:23:01 -0400 |
| parents | |
| children | f9c37d0b3002 |
| files | lorikeet.xml test-data/custom_spacers.fasta test-data/input.bam |
| diffstat | 3 files changed, 95 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lorikeet.xml Tue May 08 04:23:01 2018 -0400 @@ -0,0 +1,75 @@ +<tool id="lorikeet_spoligotype" name="lorikeet spoligotyping" version="@TOOL_VERSION@+galaxy0" profile="17.01"> + <description>M. tuberculosis DNA fingerprinting</description> + + <macros> + <token name="@TOOL_VERSION@">17</token> + </macros> + + <requirements> + <requirement type="package" version="@TOOL_VERSION@">lorikeet</requirement> + </requirements> + + <command detect_errors="exit_code"><![CDATA[ + #set $input_file = 'input.' + $input.extension + ln -s '${input}' $input_file && + lorikeet spoligotype + -o '${output_txt}' + $input_file + #if $spacer_source.source_type == 'file': + -s '${spacer_source.spacer}' + #end if + ]]> + </command> + <inputs> + <param name="input" label="Input sequences" type="data" format="bam" help="Reads of sample(s) being spoligotyped" /> + <conditional name="spacer_source"> + <param type="select" name="source_type" label="Source for spacer sequences"> + <option selected="true" value="builtin">Built-in</option> + <option value="file">File with custom spacers</option> + </param> + <when value="builtin"> + </when> + <when value="file"> + <param argument="--spacer" type="data" format="fasta" label="Spacer file" help="FASTA format file containing customer spacer library" /> + </when> + </conditional> + </inputs> + <outputs> + <data name="output_txt" format="txt" label="Spoligotype on ${on_string}" /> + </outputs> + <tests> + <test> + <param name="input" value="input.bam" ftype="bam" /> + <output name="output_txt"> + <assert_contents> + <has_text text="1111111111 1111111011 1111111111 1100001111 111" /> + </assert_contents> + </output> + </test> + <test> + <param name="input" value="input.bam" ftype="bam" /> + <param name="source_type" value="file" /> + <param name="spacer" value="custom_spacers.fasta" ftype="fasta" /> + <output name="output_txt"> + <assert_contents> + <has_text text="1111111111 0000000000 0000000000 0000000000 000" /> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ +Lorikeet_ is a tool for digital spoligotyping_ of M. tuberculosis strains +from Illumina data. Input is a file of Illumina reads and output is +a spoligotyping report. + +While by default lorikeet uses its own built-in collection of spacer +sequences, a custom file of spacers can be provided if necessary. + +.. _Lorikeet: https://github.com/AbeelLab/lorikeet +.. _spoligotyping: https://link.springer.com/protocol/10.1007%2F978-1-60327-999-4_10 + ]]> + </help> + <citations> + <citation type="doi">10.1371/journal.pmed.1001880</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/custom_spacers.fasta Tue May 08 04:23:01 2018 -0400 @@ -0,0 +1,20 @@ +>spacers_1 +ATAGAGGGTCGCCGGCTCTGGATCA +>spacers_2 +CCTCATGCTTGGGCGACAGCTTTTG +>spacers_3 +CCGTGCTTCCAGTGATCGCCTTCTA +>spacers_4 +ACGTCATACGCCGACCAATCATCAG +>spacers_5 +TTTTCTGACCACTTGTGCGGGATTA +>spacers_6 +CGTCGTCATTTCCGGCTTCAATTTC +>spacers_7 +GAGGAGAGCGAGTACTCGGGGCTGC +>spacers_8 +CGTGAAACCGCCCCCAGCCTCGCCG +>spacers_9 +ACTCGGAATCCCATGTGCTGACAGC +>spacers_10 +TCGACACCCGCTCTAGTTGACTTCC