Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example4.html @ 114:4f0ed3b5ae46
update test results
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Wed, 09 Jul 2014 15:20:38 +0200 (2014-07-09) |
parents | b3b5ee557170 |
children | 7f3f8c10f44b |
rev | line source |
---|---|
32 | 1 <!DOCTYPE html> |
2 <html> | |
3 <head> | |
4 <meta charset="UTF-8"> | |
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> |
32 | 6 |
7 <title>Blast output</title> | |
8 | |
9 <style> | |
10 body { | |
11 color: #333333; | |
12 font-family: Arial,Sans-Serif; | |
13 } | |
14 | |
15 :link { | |
16 color: #336699; | |
17 } | |
18 | |
19 .right { | |
20 float: right; | |
21 } | |
22 | |
23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
24 #strip_html_warning { | |
25 display: none; | |
26 } | |
27 | |
28 #content { | |
29 margin: 0 2em; | |
30 padding: 0.5em; | |
31 border: 1px solid #888888; | |
32 background-color: #d3dff5; | |
33 } | |
34 | |
35 h1, h2, h3, h4, h5, h6 { | |
36 color: #2A6979; | |
37 font-family: arial,verdana,sans-serif; | |
38 letter-spacing: -1px; | |
39 margin: 1.2em 0 0.3em; | |
40 } | |
41 | |
42 h1 { | |
114 | 43 font-size: 200%; |
44 } | |
45 | |
46 h2 { | |
47 font-size: 150%; | |
48 } | |
49 | |
50 h1, h2 { | |
32 | 51 border-bottom: 1px solid #CCCCCC; |
52 padding-bottom: 0.1em; | |
53 } | |
54 | |
114 | 55 h3 { |
32 | 56 font-size: 120%; |
57 font-weight: bold; | |
58 } | |
59 | |
114 | 60 h5.darkHeader { |
32 | 61 color: #4D4D4D; |
62 letter-spacing: 0; | |
63 font-weight: bold; | |
114 | 64 font-size: 108%; |
32 | 65 } |
66 | |
67 #nodata { | |
68 font-weight: bold; | |
69 } | |
70 | |
71 .index { | |
72 margin-bottom: 3em; | |
73 } | |
74 .index div.indexentry { | |
75 margin: 1.2em 1.6em; | |
76 font-weight: bold; | |
77 font-size: 100%; | |
78 } | |
79 | |
80 .headerdata { | |
81 font-size: 90%; | |
82 } | |
83 .headerdata .param { | |
84 font-weight: bold; | |
85 text-align: right; | |
86 padding: 0 1em; | |
87 } | |
88 | |
89 .grey { | |
90 background-color: #eeeeee; | |
91 border: 1px solid #cccccc; | |
92 padding: 1em; | |
93 } | |
94 | |
95 .white { | |
96 background-color: white; | |
97 border: 1px solid #cccccc; | |
98 padding: 1.5em 2%; | |
99 } | |
100 | |
101 .graphicrow { | |
102 clear: left; | |
103 width: 100%; | |
104 } | |
105 | |
106 .graphicitem { | |
107 float: left; | |
108 } | |
109 | |
110 | |
111 | |
112 .graphics .grey { | |
113 text-align: center; | |
114 } | |
115 | |
116 .graphic { | |
117 background-color: white; | |
118 border: 2px solid black; | |
119 padding: 1.5em; | |
120 margin: auto; | |
121 } | |
122 | |
123 .centered, .defline, div.legend, div.tablewrapper { | |
124 margin-left: auto; | |
125 margin-right: auto; | |
126 } | |
127 | |
128 .defline { | |
129 background-color: white; | |
130 border: 1px solid black; | |
131 margin: .5em auto; | |
132 padding-left: .2em; | |
133 padding-right: .2em; | |
134 max-width: 50em; | |
135 text-align: left; | |
136 height: 2.8em; | |
59 | 137 overflow: hidden; |
32 | 138 } |
139 | |
140 div.legend { | |
141 max-width: 40em; | |
142 } | |
143 div.legend div { | |
144 width: 100%; | |
145 color: white; | |
146 font-weight: bold; | |
147 border-spacing: 0; | |
148 } | |
149 div.legend div .graphicitem { | |
150 width: 20%; | |
151 padding: 0; | |
152 margin: 0; | |
153 border: none; | |
154 } | |
155 | |
156 div.tablewrapper { | |
157 width: 50%; | |
158 min-width: 60em; | |
159 } | |
160 | |
161 /* For small widths we give the graphic 100% */ | |
162 @media (max-width: 72.5em) { | |
163 div.tablewrapper { | |
164 width: 100%; | |
165 min-width: 0px; | |
166 } | |
167 } | |
168 | |
169 .scale { | |
170 width: 100%; | |
171 margin: .5em 0; | |
172 font-weight: bold; | |
173 } | |
174 .scale div { | |
175 color: red; | |
176 text-align: left; | |
177 } | |
178 .scale .graphicrow { | |
179 margin: .5em 0 .5em 0; | |
180 color: white; | |
181 } | |
182 .scale .graphicitem { | |
183 position: relative; | |
184 } | |
185 .scale .graphicitem div { | |
186 margin: 0 1px; | |
187 padding: 0 2px; | |
188 text-align: right; | |
189 background-color: red; | |
190 color: white; | |
191 } | |
192 .scale .graphicitem:first-child div { | |
193 margin-left: 0px; | |
194 } | |
195 .scale .graphicitem:last-child div { | |
196 margin-right: 0px; | |
197 } | |
198 .scale .graphicitem .lastlabel { | |
199 position: absolute; | |
200 top: 0px; | |
201 left: 100%; | |
202 background-color: transparent; | |
203 color: red; | |
204 } | |
205 | |
206 a.matchresult { | |
207 display: block; | |
208 margin: 0; | |
209 padding: 0; | |
210 } | |
211 div.matchrow { | |
212 margin-top: 4px; | |
213 } | |
214 div.matchrow, div.matchitem { | |
215 height: 4px; | |
216 } | |
217 | |
218 | |
219 table.descriptiontable { | |
220 font-size: 85%; | |
221 border: 1px solid #97b0c8; | |
222 border-spacing: 0; | |
223 color: #222222; | |
224 line-height: 1.3em; | |
225 background-color: white; | |
226 } | |
227 table.descriptiontable col:first-child { | |
228 width: 100%; | |
229 } | |
230 table.descriptiontable tr:hover { | |
231 background-color: #D5DEE3; | |
232 } | |
233 table.descriptiontable th { | |
234 color: #14376C; | |
235 font-weight: normal; | |
236 background-color: #F0F0F0; | |
237 background: linear-gradient(#FFFFFF, #F0F0F0); | |
238 border-bottom: 1px solid #D4DFE9; | |
239 border-right: 1px solid #CFCFCF; | |
240 border-left: 0px solid black; | |
241 border-top: 0px solid black; | |
242 } | |
243 table.descriptiontable td { | |
244 overflow: hidden; | |
245 text-align: center; | |
246 padding: .4em .8em; | |
247 } | |
248 table.descriptiontable td div { | |
249 width: 1em; | |
250 overflow: visible; | |
251 white-space: nowrap; | |
252 text-align: left; | |
253 } | |
254 | |
255 | |
256 | |
257 .alignments .white { | |
258 padding: 1.5em 1em; | |
259 } | |
260 | |
261 .alignment { | |
262 border-top: 1px solid black; | |
263 padding-left: 1em; | |
264 padding-right: 1em; | |
265 } | |
266 | |
267 div.linkheader { | |
268 padding-top: .2em; | |
269 font-size: 85%; | |
270 color: #14376C; | |
271 } | |
272 div.linkheader a.linkheader { | |
273 margin-right: 1em; | |
274 } | |
275 div.linkheader .right a { | |
276 text-decoration: none; | |
277 } | |
278 | |
279 .title .hittitle { | |
280 color: #222222; | |
281 margin-bottom: .3em; | |
282 } | |
283 .title .titleinfo { | |
284 font-size: 80%; | |
285 margin-top: 0; | |
286 margin-bottom: .3em; | |
287 } | |
288 .title .titleinfo .b { | |
289 color: #606060; | |
290 font-weight: bold; | |
291 font-size: 90%; | |
292 } | |
293 | |
294 .moretitles { | |
295 margin: 1.2em; | |
296 } | |
297 .moretitles .titleinfo { | |
298 margin: 0; | |
299 padding: 0; | |
300 } | |
301 .moretitles .hittitle { | |
302 margin: .4em 0 .2em 0; | |
303 padding: 0; | |
304 } | |
305 | |
306 a.showmoretitles { | |
307 font-size: 75%; | |
308 color: #336699; | |
309 font-weight: bold; | |
310 margin-top: 0; | |
311 } | |
312 a.showmoretitles:hover { | |
313 } | |
314 | |
315 .hotspot { | |
316 color: #606060; | |
317 font-family: verdana, arial, sans-serif; | |
318 margin-bottom: 2.5em; | |
319 } | |
320 | |
321 .hotspot p.range { | |
322 font-size: 70%; | |
323 margin-top: 0; | |
324 margin-top: 1em; | |
325 margin-bottom: .2em; | |
326 } | |
327 .hotspot p.range span.range { | |
328 font-weight: bold; | |
329 } | |
330 .hotspot p.range a.range { | |
331 margin-left: .5em; | |
332 } | |
333 | |
334 table.hotspotstable { | |
335 border-top: 1px solid; | |
336 border-bottom: 1px solid; | |
337 text-align: left; | |
338 border-collapse: collapse; | |
339 } | |
340 table.hotspotstable th, table.hotspotstable td { | |
341 padding: .1em 1em; | |
342 } | |
343 table.hotspotstable th { | |
344 font-size: 70%; | |
345 } | |
346 table.hotspotstable td { | |
347 min-width: 7em; | |
348 color: #222222; | |
349 font-size: 80%; | |
350 } | |
351 | |
352 pre.alignmentgraphic { | |
353 color: #222222; | |
354 } | |
355 | |
356 footer { | |
357 text-align: center; | |
358 color: #cccccc; | |
359 font-size: 70%; | |
360 margin-top: 1em; | |
361 } | |
362 footer :link { | |
363 color: #5588cc; | |
364 } | |
365 | |
366 </style> | |
367 | |
368 <script type="text/javascript"> | |
369 function toggle_visibility(id) { | |
370 var e = document.getElementById(id); | |
371 if(e.style.display != 'block') | |
372 e.style.display = 'block'; | |
373 else | |
374 e.style.display = 'none'; | |
375 } | |
376 </script> | |
377 | |
378 </head> | |
379 | |
380 | |
381 <body> | |
382 | |
383 <div id="strip_html_warning"> | |
384 <!-- This div should be hidden by the header css block. Galaxy | |
385 strips all css, breaking this page but making this warning | |
386 visible. This warning contains some ugly old skool tabular html | |
387 layout that is not stripped. --> | |
388 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
389 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
390 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
391 </b></font></td></tr></table> | |
392 </div> | |
393 | |
394 <div id=content> | |
395 | |
114 | 396 <section class=header> |
397 | |
398 <h1>Nucleotide Blast results</h1> | |
399 | |
400 <table class=headerdata> | |
401 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
402 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
403 </table> | |
404 | |
405 </section> | |
406 | |
32 | 407 |
408 <section class=index> | |
114 | 409 <h2>Queries</h2> |
32 | 410 |
411 <div class=indexentry><a href="#match1"> | |
412 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
413 (20 letters, 2 hits) | |
414 </a></div> | |
415 <div class=indexentry><a href="#match2"> | |
416 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
417 (20 letters, 0 hits) | |
418 </a></div> | |
419 <div class=indexentry><a href="#match3"> | |
420 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
421 (20 letters, 3 hits) | |
422 </a></div> | |
423 <div class=indexentry><a href="#match4"> | |
424 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
425 (24 letters, 0 hits) | |
426 </a></div> | |
427 <div class=indexentry><a href="#match5"> | |
428 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
429 (20 letters, 0 hits) | |
430 </a></div> | |
431 <div class=indexentry><a href="#match6"> | |
432 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
433 (25 letters, 2 hits) | |
434 </a></div> | |
435 <div class=indexentry><a href="#match7"> | |
436 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
437 (74 letters, 2 hits) | |
438 </a></div> | |
439 | |
440 </section> | |
441 | |
442 | |
443 <section class=match id=match1> | |
444 | |
114 | 445 <h2>Nucleotide Sequence (20 letters)</h2> |
32 | 446 |
447 <section class=header> | |
448 | |
449 <table class=headerdata> | |
114 | 450 <tr><td class=param>Query number:</td><td>1</td></tr> |
32 | 451 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
114 | 452 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
453 <tr><td class=param>Length:</td><td>20</td></tr> | |
32 | 454 </table> |
455 | |
456 </section> | |
457 | |
458 | |
459 <section class=graphics> | |
114 | 460 <h3>Graphic Summary</h3> |
32 | 461 |
462 <div class=grey> | |
114 | 463 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> |
32 | 464 |
465 <div class=defline id=defline1> | |
466 Mouse-over to show defline and scores, click to show alignments | |
467 </div> | |
468 | |
469 <div class=graphic> | |
114 | 470 <h5 class=darkHeader>Color key for alignment scores</h5> |
32 | 471 <div class=legend><div class=graphicrow> |
472 <div class=graphicitem style="background-color: black"><40</div> | |
473 <div class=graphicitem style="background-color: blue">40–50</div> | |
474 <div class=graphicitem style="background-color: green">50–80</div> | |
475 <div class=graphicitem style="background-color: magenta">80–200</div> | |
476 <div class=graphicitem style="background-color: red">200≤</div> | |
477 </div></div> | |
478 <div style="clear: left"></div> | |
479 | |
480 <div class=tablewrapper> | |
481 | |
482 <div class=scale> | |
483 <div>query:</div> | |
484 <div class=graphicrow> | |
485 <div> | |
77 | 486 <div class=graphicitem style="width: 10%"> |
32 | 487 <div>2</div> |
488 </div> | |
77 | 489 <div class=graphicitem style="width: 10%"> |
32 | 490 <div>4</div> |
491 </div> | |
77 | 492 <div class=graphicitem style="width: 10%"> |
32 | 493 <div>6</div> |
494 </div> | |
77 | 495 <div class=graphicitem style="width: 10%"> |
32 | 496 <div>8</div> |
497 </div> | |
77 | 498 <div class=graphicitem style="width: 10%"> |
32 | 499 <div>10</div> |
500 </div> | |
77 | 501 <div class=graphicitem style="width: 10%"> |
32 | 502 <div>12</div> |
503 </div> | |
77 | 504 <div class=graphicitem style="width: 10%"> |
32 | 505 <div>14</div> |
506 </div> | |
77 | 507 <div class=graphicitem style="width: 10%"> |
32 | 508 <div>16</div> |
509 </div> | |
77 | 510 <div class=graphicitem style="width: 10%"> |
32 | 511 <div>18</div> |
512 </div> | |
77 | 513 <div class=graphicitem style="width: 10%"> |
32 | 514 <div>20</div> |
515 </div> | |
516 </div> | |
517 </div> | |
518 <div style="clear: left"></div> | |
519 </div> | |
520 | |
521 <a class=matchresult | |
59 | 522 href="#hit1-1" |
32 | 523 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
524 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
525 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
526 <div class="matchrow graphicrow"> | |
527 <div class="matchitem graphicitem" | |
77 | 528 style="background-color: black; width: 100%"></div> |
32 | 529 </div> |
530 </a> | |
531 | |
532 <a class=matchresult | |
59 | 533 href="#hit1-2" |
32 | 534 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
535 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
536 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
537 <div class="matchrow graphicrow"> | |
538 <div class="matchitem graphicitem" | |
77 | 539 style="background-color: black; width: 100%"></div> |
32 | 540 </div> |
541 </a> | |
542 | |
543 </div> | |
544 </div> | |
545 </div> | |
546 </section> | |
547 | |
548 | |
549 | |
550 <section class=descriptions> | |
114 | 551 <h3>Descriptions</h3> |
32 | 552 |
553 <div class=grey><div class=white> | |
114 | 554 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
32 | 555 |
556 <table class=descriptiontable> | |
557 <col/><col/><col/><col/><col/><col/><col/> | |
558 <tr> | |
559 <th>Description</th> | |
560 <th>Max score</th> | |
561 <th>Total score</th> | |
562 <th>Query cover</th> | |
563 <th>E value</th> | |
564 <th>Ident</th> | |
565 <th>Accession</th> | |
566 </tr> | |
567 <tr> | |
59 | 568 <td><div><a href="#hit1-1" |
32 | 569 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
59 | 570 id="description1-1"> |
32 | 571 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
572 </a></div></td> | |
573 <td>40.1</td> | |
574 <td>40.1</td> | |
575 <td>100%</td> | |
576 <td>1.513e-07</td> | |
577 <td>100%</td> | |
105 | 578 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
32 | 579 </tr> |
580 <tr> | |
59 | 581 <td><div><a href="#hit1-2" |
32 | 582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
59 | 583 id="description1-2"> |
32 | 584 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
585 </a></div></td> | |
586 <td>40.1</td> | |
587 <td>40.1</td> | |
588 <td>100%</td> | |
589 <td>1.513e-07</td> | |
590 <td>100%</td> | |
105 | 591 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
32 | 592 </tr> |
593 </table> | |
594 | |
595 </div></div> | |
596 </section> | |
597 | |
598 | |
599 | |
600 <section class=alignments> | |
114 | 601 <h3>Alignments</h3> |
32 | 602 |
603 <div class=grey><div class=white> | |
59 | 604 <div class=alignment id=hit1-1> |
32 | 605 |
606 <div class=linkheader> | |
59 | 607 <div class=right><a href="#description1-1">Descriptions</a></div> |
105 | 608 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 609 </div> |
610 | |
611 <div class=title> | |
612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
613 <p class=titleinfo> | |
105 | 614 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
32 | 615 <span class=b>Length:</span> 2457 |
616 <span class=b>Number of Matches:</span> 1 | |
617 </p> | |
618 </div> | |
619 | |
620 | |
59 | 621 <div class=hotspot id=hotspot1-1-1> |
32 | 622 <p class=range> |
623 <span class=range>Range 1: 2119 to 2138</span> | |
624 </p> | |
625 | |
626 <table class=hotspotstable> | |
627 <tr> | |
628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
629 </tr> | |
630 <tr> | |
631 <td>40.1 bits(20)</td> | |
632 <td>0.0</td> | |
633 <td>20/20(100%)</td> | |
634 <td>0/20(0%)</td> | |
635 <td>Plus/Plus</td> | |
636 </tr> | |
637 </table> | |
638 | |
639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
640 |||||||||||||||||||| | |
641 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
642 </div> | |
643 | |
644 </div> | |
645 | |
59 | 646 <div class=alignment id=hit1-2> |
32 | 647 |
648 <div class=linkheader> | |
59 | 649 <div class=right><a href="#description1-2">Descriptions</a></div> |
105 | 650 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 651 </div> |
652 | |
653 <div class=title> | |
654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
655 <p class=titleinfo> | |
105 | 656 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
32 | 657 <span class=b>Length:</span> 323 |
658 <span class=b>Number of Matches:</span> 1 | |
659 </p> | |
660 </div> | |
661 | |
662 | |
59 | 663 <div class=hotspot id=hotspot1-2-1> |
32 | 664 <p class=range> |
665 <span class=range>Range 1: 200 to 219</span> | |
666 </p> | |
667 | |
668 <table class=hotspotstable> | |
669 <tr> | |
670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
671 </tr> | |
672 <tr> | |
673 <td>40.1 bits(20)</td> | |
674 <td>0.0</td> | |
675 <td>20/20(100%)</td> | |
676 <td>0/20(0%)</td> | |
677 <td>Plus/Plus</td> | |
678 </tr> | |
679 </table> | |
680 | |
681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
682 |||||||||||||||||||| | |
683 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
684 </div> | |
685 | |
686 </div> | |
687 | |
688 </div></div> | |
689 </section> | |
690 </section> | |
691 | |
692 <section class=match id=match2> | |
693 | |
114 | 694 <h2>Nucleotide Sequence (20 letters)</h2> |
32 | 695 |
696 <section class=header> | |
697 | |
698 <table class=headerdata> | |
114 | 699 <tr><td class=param>Query number:</td><td>2</td></tr> |
700 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
701 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
702 <tr><td class=param>Length:</td><td>20</td></tr> | |
32 | 703 </table> |
704 | |
705 </section> | |
706 | |
707 <section> | |
114 | 708 <h3>No Hits</h3> |
32 | 709 <div class=grey> |
710 <table class=headerdata> | |
711 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
712 </table> | |
713 </div> | |
714 </section> | |
715 </section> | |
716 | |
717 <section class=match id=match3> | |
718 | |
114 | 719 <h2>Nucleotide Sequence (20 letters)</h2> |
32 | 720 |
721 <section class=header> | |
722 | |
723 <table class=headerdata> | |
114 | 724 <tr><td class=param>Query number:</td><td>3</td></tr> |
725 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
726 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
727 <tr><td class=param>Length:</td><td>20</td></tr> | |
32 | 728 </table> |
729 | |
730 </section> | |
731 | |
732 | |
733 <section class=graphics> | |
114 | 734 <h3>Graphic Summary</h3> |
32 | 735 |
736 <div class=grey> | |
114 | 737 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> |
32 | 738 |
739 <div class=defline id=defline3> | |
740 Mouse-over to show defline and scores, click to show alignments | |
741 </div> | |
742 | |
743 <div class=graphic> | |
114 | 744 <h5 class=darkHeader>Color key for alignment scores</h5> |
32 | 745 <div class=legend><div class=graphicrow> |
746 <div class=graphicitem style="background-color: black"><40</div> | |
747 <div class=graphicitem style="background-color: blue">40–50</div> | |
748 <div class=graphicitem style="background-color: green">50–80</div> | |
749 <div class=graphicitem style="background-color: magenta">80–200</div> | |
750 <div class=graphicitem style="background-color: red">200≤</div> | |
751 </div></div> | |
752 <div style="clear: left"></div> | |
753 | |
754 <div class=tablewrapper> | |
755 | |
756 <div class=scale> | |
757 <div>query:</div> | |
758 <div class=graphicrow> | |
759 <div> | |
77 | 760 <div class=graphicitem style="width: 10%"> |
32 | 761 <div>2</div> |
762 </div> | |
77 | 763 <div class=graphicitem style="width: 10%"> |
32 | 764 <div>4</div> |
765 </div> | |
77 | 766 <div class=graphicitem style="width: 10%"> |
32 | 767 <div>6</div> |
768 </div> | |
77 | 769 <div class=graphicitem style="width: 10%"> |
32 | 770 <div>8</div> |
771 </div> | |
77 | 772 <div class=graphicitem style="width: 10%"> |
32 | 773 <div>10</div> |
774 </div> | |
77 | 775 <div class=graphicitem style="width: 10%"> |
32 | 776 <div>12</div> |
777 </div> | |
77 | 778 <div class=graphicitem style="width: 10%"> |
32 | 779 <div>14</div> |
780 </div> | |
77 | 781 <div class=graphicitem style="width: 10%"> |
32 | 782 <div>16</div> |
783 </div> | |
77 | 784 <div class=graphicitem style="width: 10%"> |
32 | 785 <div>18</div> |
786 </div> | |
77 | 787 <div class=graphicitem style="width: 10%"> |
32 | 788 <div>20</div> |
789 </div> | |
790 </div> | |
791 </div> | |
792 <div style="clear: left"></div> | |
793 </div> | |
794 | |
795 <a class=matchresult | |
59 | 796 href="#hit3-1" |
32 | 797 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
798 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
799 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
800 <div class="matchrow graphicrow"> | |
801 <div class="matchitem graphicitem" | |
77 | 802 style="background-color: black; width: 100%"></div> |
32 | 803 </div> |
804 </a> | |
805 | |
806 <a class=matchresult | |
59 | 807 href="#hit3-2" |
32 | 808 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
809 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
810 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
811 <div class="matchrow graphicrow"> | |
812 <div class="matchitem graphicitem" | |
77 | 813 style="background-color: black; width: 100%"></div> |
32 | 814 </div> |
815 </a> | |
816 | |
817 <a class=matchresult | |
59 | 818 href="#hit3-3" |
32 | 819 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
820 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
821 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
822 <div class="matchrow graphicrow"> | |
823 <div class="matchitem graphicitem" | |
77 | 824 style="background-color: transparent; width: 15%"></div> |
32 | 825 <div class="matchitem graphicitem" |
77 | 826 style="background-color: black; width: 85%"></div> |
32 | 827 </div> |
828 </a> | |
829 | |
830 </div> | |
831 </div> | |
832 </div> | |
833 </section> | |
834 | |
835 | |
836 | |
837 <section class=descriptions> | |
114 | 838 <h3>Descriptions</h3> |
32 | 839 |
840 <div class=grey><div class=white> | |
114 | 841 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
32 | 842 |
843 <table class=descriptiontable> | |
844 <col/><col/><col/><col/><col/><col/><col/> | |
845 <tr> | |
846 <th>Description</th> | |
847 <th>Max score</th> | |
848 <th>Total score</th> | |
849 <th>Query cover</th> | |
850 <th>E value</th> | |
851 <th>Ident</th> | |
852 <th>Accession</th> | |
853 </tr> | |
854 <tr> | |
59 | 855 <td><div><a href="#hit3-1" |
32 | 856 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
59 | 857 id="description3-1"> |
32 | 858 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
859 </a></div></td> | |
860 <td>40.1</td> | |
861 <td>40.1</td> | |
862 <td>100%</td> | |
863 <td>1.513e-07</td> | |
864 <td>100%</td> | |
105 | 865 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
32 | 866 </tr> |
867 <tr> | |
59 | 868 <td><div><a href="#hit3-2" |
32 | 869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
59 | 870 id="description3-2"> |
32 | 871 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
872 </a></div></td> | |
873 <td>40.1</td> | |
874 <td>40.1</td> | |
875 <td>100%</td> | |
876 <td>1.513e-07</td> | |
877 <td>100%</td> | |
105 | 878 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
32 | 879 </tr> |
880 <tr> | |
59 | 881 <td><div><a href="#hit3-3" |
32 | 882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
59 | 883 id="description3-3"> |
32 | 884 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
885 </a></div></td> | |
886 <td>34.2</td> | |
887 <td>34.2</td> | |
888 <td>85%</td> | |
889 <td>9.334e-06</td> | |
890 <td>100%</td> | |
105 | 891 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">1</a></td> |
32 | 892 </tr> |
893 </table> | |
894 | |
895 </div></div> | |
896 </section> | |
897 | |
898 | |
899 | |
900 <section class=alignments> | |
114 | 901 <h3>Alignments</h3> |
32 | 902 |
903 <div class=grey><div class=white> | |
59 | 904 <div class=alignment id=hit3-1> |
32 | 905 |
906 <div class=linkheader> | |
59 | 907 <div class=right><a href="#description3-1">Descriptions</a></div> |
105 | 908 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 909 </div> |
910 | |
911 <div class=title> | |
912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
913 <p class=titleinfo> | |
105 | 914 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
32 | 915 <span class=b>Length:</span> 2457 |
916 <span class=b>Number of Matches:</span> 1 | |
917 </p> | |
918 </div> | |
919 | |
920 | |
59 | 921 <div class=hotspot id=hotspot3-1-1> |
32 | 922 <p class=range> |
923 <span class=range>Range 1: 2143 to 2162</span> | |
924 </p> | |
925 | |
926 <table class=hotspotstable> | |
927 <tr> | |
928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
929 </tr> | |
930 <tr> | |
931 <td>40.1 bits(20)</td> | |
932 <td>0.0</td> | |
933 <td>20/20(100%)</td> | |
934 <td>0/20(0%)</td> | |
935 <td>Plus/Plus</td> | |
936 </tr> | |
937 </table> | |
938 | |
939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
940 |||||||||||||||||||| | |
941 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
942 </div> | |
943 | |
944 </div> | |
945 | |
59 | 946 <div class=alignment id=hit3-2> |
32 | 947 |
948 <div class=linkheader> | |
59 | 949 <div class=right><a href="#description3-2">Descriptions</a></div> |
105 | 950 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 951 </div> |
952 | |
953 <div class=title> | |
954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
955 <p class=titleinfo> | |
105 | 956 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
32 | 957 <span class=b>Length:</span> 323 |
958 <span class=b>Number of Matches:</span> 1 | |
959 </p> | |
960 </div> | |
961 | |
962 | |
59 | 963 <div class=hotspot id=hotspot3-2-1> |
32 | 964 <p class=range> |
965 <span class=range>Range 1: 224 to 243</span> | |
966 </p> | |
967 | |
968 <table class=hotspotstable> | |
969 <tr> | |
970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
971 </tr> | |
972 <tr> | |
973 <td>40.1 bits(20)</td> | |
974 <td>0.0</td> | |
975 <td>20/20(100%)</td> | |
976 <td>0/20(0%)</td> | |
977 <td>Plus/Plus</td> | |
978 </tr> | |
979 </table> | |
980 | |
981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
982 |||||||||||||||||||| | |
983 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
984 </div> | |
985 | |
986 </div> | |
987 | |
59 | 988 <div class=alignment id=hit3-3> |
32 | 989 |
990 <div class=linkheader> | |
59 | 991 <div class=right><a href="#description3-3">Descriptions</a></div> |
105 | 992 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 993 </div> |
994 | |
995 <div class=title> | |
996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
997 <p class=titleinfo> | |
105 | 998 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|1</a> |
32 | 999 <span class=b>Length:</span> 1045 |
1000 <span class=b>Number of Matches:</span> 1 | |
1001 </p> | |
1002 </div> | |
1003 | |
1004 | |
59 | 1005 <div class=hotspot id=hotspot3-3-1> |
32 | 1006 <p class=range> |
1007 <span class=range>Range 1: 2 to 18</span> | |
1008 </p> | |
1009 | |
1010 <table class=hotspotstable> | |
1011 <tr> | |
1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
1013 </tr> | |
1014 <tr> | |
1015 <td>34.2 bits(17)</td> | |
1016 <td>0.0</td> | |
1017 <td>17/17(100%)</td> | |
1018 <td>0/17(0%)</td> | |
1019 <td>Plus/Plus</td> | |
1020 </tr> | |
1021 </table> | |
1022 | |
1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
1024 ||||||||||||||||| | |
1025 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
1026 </div> | |
1027 | |
1028 </div> | |
1029 | |
1030 </div></div> | |
1031 </section> | |
1032 </section> | |
1033 | |
1034 <section class=match id=match4> | |
1035 | |
114 | 1036 <h2>Nucleotide Sequence (24 letters)</h2> |
32 | 1037 |
1038 <section class=header> | |
1039 | |
1040 <table class=headerdata> | |
114 | 1041 <tr><td class=param>Query number:</td><td>4</td></tr> |
1042 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
1043 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
1044 <tr><td class=param>Length:</td><td>24</td></tr> | |
32 | 1045 </table> |
1046 | |
1047 </section> | |
1048 | |
1049 <section> | |
114 | 1050 <h3>No Hits</h3> |
32 | 1051 <div class=grey> |
1052 <table class=headerdata> | |
1053 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
1054 </table> | |
1055 </div> | |
1056 </section> | |
1057 </section> | |
1058 | |
1059 <section class=match id=match5> | |
1060 | |
114 | 1061 <h2>Nucleotide Sequence (20 letters)</h2> |
32 | 1062 |
1063 <section class=header> | |
1064 | |
1065 <table class=headerdata> | |
114 | 1066 <tr><td class=param>Query number:</td><td>5</td></tr> |
1067 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
1068 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
1069 <tr><td class=param>Length:</td><td>20</td></tr> | |
32 | 1070 </table> |
1071 | |
1072 </section> | |
1073 | |
1074 <section> | |
114 | 1075 <h3>No Hits</h3> |
32 | 1076 <div class=grey> |
1077 <table class=headerdata> | |
1078 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
1079 </table> | |
1080 </div> | |
1081 </section> | |
1082 </section> | |
1083 | |
1084 <section class=match id=match6> | |
1085 | |
114 | 1086 <h2>Nucleotide Sequence (25 letters)</h2> |
32 | 1087 |
1088 <section class=header> | |
1089 | |
1090 <table class=headerdata> | |
114 | 1091 <tr><td class=param>Query number:</td><td>6</td></tr> |
1092 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
1093 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
1094 <tr><td class=param>Length:</td><td>25</td></tr> | |
32 | 1095 </table> |
1096 | |
1097 </section> | |
1098 | |
1099 | |
1100 <section class=graphics> | |
114 | 1101 <h3>Graphic Summary</h3> |
32 | 1102 |
1103 <div class=grey> | |
114 | 1104 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> |
32 | 1105 |
1106 <div class=defline id=defline6> | |
1107 Mouse-over to show defline and scores, click to show alignments | |
1108 </div> | |
1109 | |
1110 <div class=graphic> | |
114 | 1111 <h5 class=darkHeader>Color key for alignment scores</h5> |
32 | 1112 <div class=legend><div class=graphicrow> |
1113 <div class=graphicitem style="background-color: black"><40</div> | |
1114 <div class=graphicitem style="background-color: blue">40–50</div> | |
1115 <div class=graphicitem style="background-color: green">50–80</div> | |
1116 <div class=graphicitem style="background-color: magenta">80–200</div> | |
1117 <div class=graphicitem style="background-color: red">200≤</div> | |
1118 </div></div> | |
1119 <div style="clear: left"></div> | |
1120 | |
1121 <div class=tablewrapper> | |
1122 | |
1123 <div class=scale> | |
1124 <div>query:</div> | |
1125 <div class=graphicrow> | |
1126 <div> | |
77 | 1127 <div class=graphicitem style="width: 12%"> |
32 | 1128 <div>3</div> |
1129 </div> | |
77 | 1130 <div class=graphicitem style="width: 12%"> |
32 | 1131 <div>6</div> |
1132 </div> | |
77 | 1133 <div class=graphicitem style="width: 12%"> |
32 | 1134 <div>9</div> |
1135 </div> | |
77 | 1136 <div class=graphicitem style="width: 12%"> |
32 | 1137 <div>12</div> |
1138 </div> | |
77 | 1139 <div class=graphicitem style="width: 12%"> |
32 | 1140 <div>15</div> |
1141 </div> | |
77 | 1142 <div class=graphicitem style="width: 12%"> |
32 | 1143 <div>18</div> |
1144 </div> | |
77 | 1145 <div class=graphicitem style="width: 12%"> |
32 | 1146 <div>21</div> |
1147 </div> | |
77 | 1148 <div class=graphicitem style="width: 12%"> |
32 | 1149 <div>24</div> |
1150 </div> | |
77 | 1151 <div class=graphicitem style="width: 4%"> |
32 | 1152 <div>25</div> |
1153 </div> | |
1154 </div> | |
1155 </div> | |
1156 <div style="clear: left"></div> | |
1157 </div> | |
1158 | |
1159 <a class=matchresult | |
59 | 1160 href="#hit6-1" |
32 | 1161 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
1162 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
1163 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
1164 <div class="matchrow graphicrow"> | |
1165 <div class="matchitem graphicitem" | |
77 | 1166 style="background-color: black; width: 88%"></div> |
32 | 1167 <div class="matchitem graphicitem" |
77 | 1168 style="background-color: transparent; width: 12%"></div> |
32 | 1169 </div> |
1170 </a> | |
1171 | |
1172 <a class=matchresult | |
59 | 1173 href="#hit6-2" |
32 | 1174 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
1175 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
1176 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
1177 <div class="matchrow graphicrow"> | |
1178 <div class="matchitem graphicitem" | |
77 | 1179 style="background-color: black; width: 88%"></div> |
32 | 1180 <div class="matchitem graphicitem" |
77 | 1181 style="background-color: transparent; width: 12%"></div> |
32 | 1182 </div> |
1183 </a> | |
1184 | |
1185 </div> | |
1186 </div> | |
1187 </div> | |
1188 </section> | |
1189 | |
1190 | |
1191 | |
1192 <section class=descriptions> | |
114 | 1193 <h3>Descriptions</h3> |
32 | 1194 |
1195 <div class=grey><div class=white> | |
114 | 1196 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
32 | 1197 |
1198 <table class=descriptiontable> | |
1199 <col/><col/><col/><col/><col/><col/><col/> | |
1200 <tr> | |
1201 <th>Description</th> | |
1202 <th>Max score</th> | |
1203 <th>Total score</th> | |
1204 <th>Query cover</th> | |
1205 <th>E value</th> | |
1206 <th>Ident</th> | |
1207 <th>Accession</th> | |
1208 </tr> | |
1209 <tr> | |
59 | 1210 <td><div><a href="#hit6-1" |
32 | 1211 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
59 | 1212 id="description6-1"> |
32 | 1213 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
1214 </a></div></td> | |
1215 <td>36.2</td> | |
1216 <td>36.2</td> | |
1217 <td>88%</td> | |
1218 <td>3.148e-06</td> | |
1219 <td>95%</td> | |
105 | 1220 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
32 | 1221 </tr> |
1222 <tr> | |
59 | 1223 <td><div><a href="#hit6-2" |
32 | 1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
59 | 1225 id="description6-2"> |
32 | 1226 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
1227 </a></div></td> | |
1228 <td>36.2</td> | |
1229 <td>36.2</td> | |
1230 <td>88%</td> | |
1231 <td>3.148e-06</td> | |
1232 <td>95%</td> | |
105 | 1233 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
32 | 1234 </tr> |
1235 </table> | |
1236 | |
1237 </div></div> | |
1238 </section> | |
1239 | |
1240 | |
1241 | |
1242 <section class=alignments> | |
114 | 1243 <h3>Alignments</h3> |
32 | 1244 |
1245 <div class=grey><div class=white> | |
59 | 1246 <div class=alignment id=hit6-1> |
32 | 1247 |
1248 <div class=linkheader> | |
59 | 1249 <div class=right><a href="#description6-1">Descriptions</a></div> |
105 | 1250 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 1251 </div> |
1252 | |
1253 <div class=title> | |
1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
1255 <p class=titleinfo> | |
105 | 1256 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
32 | 1257 <span class=b>Length:</span> 4983 |
1258 <span class=b>Number of Matches:</span> 1 | |
1259 </p> | |
1260 </div> | |
1261 | |
1262 | |
59 | 1263 <div class=hotspot id=hotspot6-1-1> |
32 | 1264 <p class=range> |
1265 <span class=range>Range 1: 2344 to 2365</span> | |
1266 </p> | |
1267 | |
1268 <table class=hotspotstable> | |
1269 <tr> | |
1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
1271 </tr> | |
1272 <tr> | |
1273 <td>36.2 bits(18)</td> | |
1274 <td>0.0</td> | |
1275 <td>21/22(95%)</td> | |
1276 <td>0/22(0%)</td> | |
1277 <td>Plus/Plus</td> | |
1278 </tr> | |
1279 </table> | |
1280 | |
1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
1282 |||||||||||||| ||||||| | |
1283 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | |
1284 </div> | |
1285 | |
1286 </div> | |
1287 | |
59 | 1288 <div class=alignment id=hit6-2> |
32 | 1289 |
1290 <div class=linkheader> | |
59 | 1291 <div class=right><a href="#description6-2">Descriptions</a></div> |
105 | 1292 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 1293 </div> |
1294 | |
1295 <div class=title> | |
1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
1297 <p class=titleinfo> | |
105 | 1298 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
32 | 1299 <span class=b>Length:</span> 4180 |
1300 <span class=b>Number of Matches:</span> 1 | |
1301 </p> | |
1302 </div> | |
1303 | |
1304 | |
59 | 1305 <div class=hotspot id=hotspot6-2-1> |
32 | 1306 <p class=range> |
1307 <span class=range>Range 1: 1541 to 1562</span> | |
1308 </p> | |
1309 | |
1310 <table class=hotspotstable> | |
1311 <tr> | |
1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
1313 </tr> | |
1314 <tr> | |
1315 <td>36.2 bits(18)</td> | |
1316 <td>0.0</td> | |
1317 <td>21/22(95%)</td> | |
1318 <td>0/22(0%)</td> | |
1319 <td>Plus/Plus</td> | |
1320 </tr> | |
1321 </table> | |
1322 | |
1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
1324 |||||||||||||| ||||||| | |
1325 Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre> | |
1326 </div> | |
1327 | |
1328 </div> | |
1329 | |
1330 </div></div> | |
1331 </section> | |
1332 </section> | |
1333 | |
1334 <section class=match id=match7> | |
1335 | |
114 | 1336 <h2>Nucleotide Sequence (74 letters)</h2> |
32 | 1337 |
1338 <section class=header> | |
1339 | |
1340 <table class=headerdata> | |
114 | 1341 <tr><td class=param>Query number:</td><td>7</td></tr> |
1342 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
1343 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
1344 <tr><td class=param>Length:</td><td>74</td></tr> | |
32 | 1345 </table> |
1346 | |
1347 </section> | |
1348 | |
1349 | |
1350 <section class=graphics> | |
114 | 1351 <h3>Graphic Summary</h3> |
32 | 1352 |
1353 <div class=grey> | |
114 | 1354 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> |
32 | 1355 |
1356 <div class=defline id=defline7> | |
1357 Mouse-over to show defline and scores, click to show alignments | |
1358 </div> | |
1359 | |
1360 <div class=graphic> | |
114 | 1361 <h5 class=darkHeader>Color key for alignment scores</h5> |
32 | 1362 <div class=legend><div class=graphicrow> |
1363 <div class=graphicitem style="background-color: black"><40</div> | |
1364 <div class=graphicitem style="background-color: blue">40–50</div> | |
1365 <div class=graphicitem style="background-color: green">50–80</div> | |
1366 <div class=graphicitem style="background-color: magenta">80–200</div> | |
1367 <div class=graphicitem style="background-color: red">200≤</div> | |
1368 </div></div> | |
1369 <div style="clear: left"></div> | |
1370 | |
1371 <div class=tablewrapper> | |
1372 | |
1373 <div class=scale> | |
1374 <div>query:</div> | |
1375 <div class=graphicrow> | |
1376 <div> | |
77 | 1377 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1378 <div>8</div> |
1379 </div> | |
77 | 1380 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1381 <div>16</div> |
1382 </div> | |
77 | 1383 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1384 <div>24</div> |
1385 </div> | |
77 | 1386 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1387 <div>32</div> |
1388 </div> | |
77 | 1389 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1390 <div>40</div> |
1391 </div> | |
77 | 1392 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1393 <div>48</div> |
1394 </div> | |
77 | 1395 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1396 <div>56</div> |
1397 </div> | |
77 | 1398 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1399 <div>64</div> |
1400 </div> | |
77 | 1401 <div class=graphicitem style="width: 10.8108108108%"> |
32 | 1402 <div>72</div> |
1403 </div> | |
77 | 1404 <div class=graphicitem style="width: 2.7027027027%"> |
32 | 1405 <div> </div> |
1406 <div class=lastlabel>74</div> | |
1407 </div> | |
1408 </div> | |
1409 </div> | |
1410 <div style="clear: left"></div> | |
1411 </div> | |
1412 | |
1413 <a class=matchresult | |
59 | 1414 href="#hit7-1" |
32 | 1415 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
1416 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
1417 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
1418 <div class="matchrow graphicrow"> | |
1419 <div class="matchitem graphicitem" | |
77 | 1420 style="background-color: green; width: 100%"></div> |
32 | 1421 </div> |
1422 </a> | |
1423 | |
1424 <a class=matchresult | |
59 | 1425 href="#hit7-2" |
32 | 1426 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
1427 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
1428 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
1429 <div class="matchrow graphicrow"> | |
1430 <div class="matchitem graphicitem" | |
77 | 1431 style="background-color: green; width: 100%"></div> |
32 | 1432 </div> |
1433 </a> | |
1434 | |
1435 </div> | |
1436 </div> | |
1437 </div> | |
1438 </section> | |
1439 | |
1440 | |
1441 | |
1442 <section class=descriptions> | |
114 | 1443 <h3>Descriptions</h3> |
32 | 1444 |
1445 <div class=grey><div class=white> | |
114 | 1446 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
32 | 1447 |
1448 <table class=descriptiontable> | |
1449 <col/><col/><col/><col/><col/><col/><col/> | |
1450 <tr> | |
1451 <th>Description</th> | |
1452 <th>Max score</th> | |
1453 <th>Total score</th> | |
1454 <th>Query cover</th> | |
1455 <th>E value</th> | |
1456 <th>Ident</th> | |
1457 <th>Accession</th> | |
1458 </tr> | |
1459 <tr> | |
59 | 1460 <td><div><a href="#hit7-1" |
32 | 1461 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
59 | 1462 id="description7-1"> |
32 | 1463 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
1464 </a></div></td> | |
1465 <td>67.9</td> | |
1466 <td>67.9</td> | |
1467 <td>100%</td> | |
1468 <td>3.564e-15</td> | |
1469 <td>86%</td> | |
105 | 1470 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
32 | 1471 </tr> |
1472 <tr> | |
59 | 1473 <td><div><a href="#hit7-2" |
32 | 1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
59 | 1475 id="description7-2"> |
32 | 1476 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
1477 </a></div></td> | |
1478 <td>67.9</td> | |
1479 <td>67.9</td> | |
1480 <td>100%</td> | |
1481 <td>3.564e-15</td> | |
1482 <td>86%</td> | |
105 | 1483 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
32 | 1484 </tr> |
1485 </table> | |
1486 | |
1487 </div></div> | |
1488 </section> | |
1489 | |
1490 | |
1491 | |
1492 <section class=alignments> | |
114 | 1493 <h3>Alignments</h3> |
32 | 1494 |
1495 <div class=grey><div class=white> | |
59 | 1496 <div class=alignment id=hit7-1> |
32 | 1497 |
1498 <div class=linkheader> | |
59 | 1499 <div class=right><a href="#description7-1">Descriptions</a></div> |
105 | 1500 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 1501 </div> |
1502 | |
1503 <div class=title> | |
1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
1505 <p class=titleinfo> | |
105 | 1506 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
32 | 1507 <span class=b>Length:</span> 4983 |
1508 <span class=b>Number of Matches:</span> 1 | |
1509 </p> | |
1510 </div> | |
1511 | |
1512 | |
59 | 1513 <div class=hotspot id=hotspot7-1-1> |
32 | 1514 <p class=range> |
1515 <span class=range>Range 1: 2319 to 2392</span> | |
1516 </p> | |
1517 | |
1518 <table class=hotspotstable> | |
1519 <tr> | |
1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
1521 </tr> | |
1522 <tr> | |
1523 <td>67.9 bits(34)</td> | |
1524 <td>0.0</td> | |
1525 <td>64/74(86%)</td> | |
1526 <td>0/74(0%)</td> | |
1527 <td>Plus/Plus</td> | |
1528 </tr> | |
1529 </table> | |
1530 | |
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1532 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1533 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1534 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1535 ||||| |||||||| |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1536 Subject 2379 TTCGCCGTCCAGAA 2392</pre> |
32 | 1537 </div> |
1538 | |
1539 </div> | |
1540 | |
59 | 1541 <div class=alignment id=hit7-2> |
32 | 1542 |
1543 <div class=linkheader> | |
59 | 1544 <div class=right><a href="#description7-2">Descriptions</a></div> |
105 | 1545 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
32 | 1546 </div> |
1547 | |
1548 <div class=title> | |
1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
1550 <p class=titleinfo> | |
105 | 1551 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
32 | 1552 <span class=b>Length:</span> 4180 |
1553 <span class=b>Number of Matches:</span> 1 | |
1554 </p> | |
1555 </div> | |
1556 | |
1557 | |
59 | 1558 <div class=hotspot id=hotspot7-2-1> |
32 | 1559 <p class=range> |
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1560 <span class=range>Range 1: 1589 to 1516</span> |
32 | 1561 </p> |
1562 | |
1563 <table class=hotspotstable> | |
1564 <tr> | |
1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
1566 </tr> | |
1567 <tr> | |
1568 <td>67.9 bits(34)</td> | |
1569 <td>0.0</td> | |
1570 <td>64/74(86%)</td> | |
1571 <td>0/74(0%)</td> | |
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1572 <td>Plus/Minus</td> |
32 | 1573 </tr> |
1574 </table> | |
1575 | |
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1577 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1578 Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> |
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1579 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1580 ||||| |||||||| |
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1581 Subject 1529 TTCGCCGTCCAGAA 1516</pre> |
32 | 1582 </div> |
1583 | |
1584 </div> | |
1585 | |
1586 </div></div> | |
1587 </section> | |
1588 </section> | |
1589 | |
1590 </div> | |
1591 | |
1592 <footer> | |
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
1593 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. |
32 | 1594 </footer> |
1595 </body> | |
1596 </html> | |
1597 |