cutadapt: cutadapt.xml annotate

annotate cutadapt.xml @ 19:49370cb85f0f draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 6318c53e772ed592862729f3048ed9bd3a711969

author	iuc
date	Tue, 18 Dec 2018 14:09:53 -0500
parents	5c7e7d905b33
children	e4691e1589d3

rev	line source
19 49370cb85f0f planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 6318c53e772ed592862729f3048ed9bd3a711969 iuc parents: 18 diff changeset	1 <tool id="cutadapt" name="Cutadapt" version="1.16.5" profile="17.09">
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	2 <description>Remove adapter sequences from Fastq/Fasta</description>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	3 <macros>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	4 <import>macros.xml</import>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	5 </macros>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	6 <requirements>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	7 <requirement type="package" version="1.16">cutadapt</requirement>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	8 </requirements>
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	9
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	10 <version_command>cutadapt --version</version_command>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	11
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	12 <command detect_errors="exit_code"><![CDATA[
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	13 ## Link in the input and output files, so Cutadapt can tell their type
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	14
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	15 #import re
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	16 #set read1 = "input_f"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	17 #set read2 = "input_r"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	18 #set paired = False
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	19 #set library_type = str($library.type)
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	20 #if $library_type == 'paired':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	21 #set paired = True
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	22 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.element_identifier))
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	23 #set read2 = re.sub('[^\w\-\s]', '_', str($library.input_2.element_identifier))
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	24 #set input_1 = $library.input_1
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	25 #set input_2 = $library.input_2
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	26 #else if $library_type == 'paired_collection'
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	27 #set paired = True
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	28 #set input_1 = $library.input_1.forward
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	29 #set input_2 = $library.input_1.reverse
14 c76ee709ffb9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 32b4794bb410494ffcfa0da397aaca7fd830a705 iuc parents: 13 diff changeset	30 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.name)) + "_1"
c76ee709ffb9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 32b4794bb410494ffcfa0da397aaca7fd830a705 iuc parents: 13 diff changeset	31 #set read2 = re.sub('[^\w\-\s]', '_', str($library.input_1.name)) + "_2"
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	32 #else
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	33 #set input_1 = $library.input_1
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	34 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.element_identifier))
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	35 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	36
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	37 #if $input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	38 #set read1 = $read1 + ".fq.gz"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	39 #set out1 = "out1.gz"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	40 #else if $input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	41 #set read1 = $read1 + ".fq.bz2"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	42 #set out1 = "out1.bz2"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	43 #else if $input_1.is_of_type('fasta'):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	44 #set read1 = $read1 + ".fa"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	45 #set out1 = "out1.fa"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	46 #else:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	47 #set read1 = $read1 + ".fq"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	48 #set out1 = "out1.fq"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	49 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	50 ln -f -s '${input_1}' '$read1' &&
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	51
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	52 #if $paired:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	53 #if $input_2.is_of_type("fastq.gz", "fastqsanger.gz"):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	54 #set read2 = $read2 + ".fq.gz"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	55 #set out2 = "out2.gz"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	56 #else if $input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	57 #set read2 = $read2 + ".fq.bz2"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	58 #set out2 = "out2.bz2"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	59 #else if $input_2.is_of_type('fasta'):
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	60 #set read2 = $read2 + ".fa"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	61 #set out2 = "out2.fa"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	62 #else:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	63 #set read2 = $read2 + ".fq"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	64 #set out2 = "out2.fq"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	65 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	66 ln -f -s '${input_2}' '$read2' &&
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	67 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	68
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	69 ## Run Cutadapt
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	70
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	71 #if $output_options.multiple_output:
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	72 mkdir split &&
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	73 #end if
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	74
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	75 cutadapt
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	76
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	77 ## cutadapt (up to version 1.16) can't be run in multicore mode with these options
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	78 #if not any(($output_options.info_file, $output_options.rest_file, $output_options.wildcard_file, $output_options.too_short_file, $output_options.too_long_file, $output_options.untrimmed_file))
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	79 -j \${GALAXY_SLOTS:-1}
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	80 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	81
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	82 #if str( $library.type ) == "single":
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	83 @read1_options@
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	84 #if $output_options.multiple_output:
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	85 --output='split/{name}.${input_1.ext}'
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	86 #else:
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	87 --output='$out1'
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	88 #end if
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	89 #else:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	90 @read1_options@
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	91 @read2_options@
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	92 --output='$out1'
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	93 --paired-output='$out2'
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	94 #end if
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	95
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	96 --error-rate=$adapter_options.error_rate
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	97 --times=$adapter_options.count
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	98 --overlap=$adapter_options.overlap
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	99 $adapter_options.no_indels
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	100 $adapter_options.match_read_wildcards
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	101 $adapter_options.no_trim
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	102 $adapter_options.mask_adapter
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	103
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	104 $filter_options.discard
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	105 $filter_options.discard_untrimmed
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	106 #if str($filter_options.min) != '0':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	107 --minimum-length=$filter_options.min
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	108 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	109 #if str($filter_options.max) != '0':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	110 --maximum-length=$filter_options.max
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	111 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	112 #if $filter_options.max_n:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	113 --max-n=$filter_options.max_n
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	114 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	115 #if str( $library.type ) != "single":
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	116 #if $filter_options.pair_filter:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	117 --pair-filter=$filter_options.pair_filter
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	118 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	119 #end if
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	120
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	121
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	122 #if str($read_mod_options.quality_cutoff) != '0':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	123 --quality-cutoff=$read_mod_options.quality_cutoff
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	124 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	125 #if str($read_mod_options.nextseq_trim) != '0':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	126 --nextseq-trim=$read_mod_options.nextseq_trim
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	127 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	128 $read_mod_options.trim_n
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	129 #if $read_mod_options.prefix != '':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	130 --prefix="$read_mod_options.prefix"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	131 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	132 #if $read_mod_options.suffix != '':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	133 --suffix="$read_mod_options.suffix"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	134 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	135 #if str($read_mod_options.length) != '0':
17 52ef1be47553 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 5b7bf5d9a56f6aabaf7951d3e32a082c91937360 iuc parents: 16 diff changeset	136 --length=$read_mod_options.length
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	137 #end if
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	138 #if $read_mod_options.length_tag != '':
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	139 --length-tag="$read_mod_options.length_tag"
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	140 #end if
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	141
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	142 '${read1}'
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	143 #if $paired:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	144 '${read2}'
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	145 #end if
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	146
13 f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	147 #if $output_options.report:
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	148 > report.txt
f5fdf41c08b8 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 1663496ce146a311569a340b0b809dc5127e0830 iuc parents: 12 diff changeset	149 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	150 ]]></command>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	151 <inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	152
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	153 <!-- Reads -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	154 <conditional name="library">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	155 <param name="type" type="select" label="Single-end or Paired-end reads?">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	156 <option value="single">Single-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	157 <option value="paired">Paired-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	158 <option value="paired_collection">Paired-end Collection</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	159 </param>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	160
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	161 <when value="single">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	162 <param name="input_1" format="fastq.gz,fastq,fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	163 <expand macro="single_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	164 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	165
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	166 <when value="paired">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	167 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #1" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	168 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #2" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	169 <expand macro="paired_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	170 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	171
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	172 <when value="paired_collection">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	173 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data_collection" collection_type="paired" label="Paired Collection" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	174 <expand macro="paired_end_options" />
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	175 </when>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	176
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	177 </conditional>
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	178
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	179 <!-- Adapter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	180 <section name="adapter_options" title="Adapter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	181 <param name="error_rate" argument="--error-rate" type="float" min="0" max="1" value="0.1" label="Maximum error rate" help="Maximum allowed error rate (no. of errors divided by the length of the matching region)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	182 <param name="no_indels" argument="--no-indels" type="boolean" value="False" truevalue="--no-indels" falsevalue="" label="Do not allow indels (Use ONLY with anchored 5' (front) adapters)." help="Do not allow indels in the alignments. That is, allow only mismatches. This option is currently only supported for anchored 5' adapters ('^ADAPTER') (default: both mismatches and indels are allowed)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	183 <param name="count" argument="--times" type="integer" min="1" value="1" label="Match times" help="Try to remove adapters at most COUNT times. Useful when an adapter gets appended multiple times." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	184 <param name="overlap" argument="--overlap" type="integer" min="1" value="3" label="Minimum overlap length" help="Minimum overlap length. If the overlap between the adapter and the sequence is shorter than LENGTH, the read is not modified. This reduces the number of bases trimmed purely due to short random adapter matches." />
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	185 <param name="match_read_wildcards" type="select" label="Match Wildcards" help="Allow 'N's as matches. Default: In the adapters but not in the reads">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	186 <option value=" " selected="True">In the adapters but not in the reads</option>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	187 <option value="--match-read-wildcards">In the adapters and in the reads</option>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	188 <option value="--no-match-adapter-wildcards">Nowhere</option>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	189 </param>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	190 <param name="no_trim" argument="--no-trim" type="boolean" value="False" truevalue="--no-trim" falsevalue="" label="Do not trim adapters" help="Match and redirect reads to output/untrimmed-output as usual, but don't remove the adapters (default: trim the adapters)." />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	191 <param name="mask_adapter" argument="--mask-adapter" type="boolean" value="False" truevalue="--mask-adapter" falsevalue="" label="Mask Adapters" help="Mask adapter bases with 'N' instead of trimming them (default: trim adapters)." />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	192 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	193
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	194 <!-- Filter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	195 <section name="filter_options" title="Filter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	196 <param name="discard" argument="--discard-trimmed" type="boolean" value="False" truevalue="--discard" falsevalue="" label="Discard Trimmed Reads" help="Discard reads that contain the adapter instead of trimming them. Use the 'Minimum overlap length' option in order to avoid throwing away too many randomly matching reads!" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	197 <param name="discard_untrimmed" argument="--discard_untrimmed" type="boolean" value="False" truevalue="--discard-untrimmed" falsevalue="" label="Discard Untrimmed Reads" help="Discard reads that do not contain the adapter." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	198 <param name="min" argument="--minimum-length" type="integer" min="0" optional="True" value="0" label="Minimum length" help="Discard trimmed reads that are shorter than LENGTH. Reads that are too short even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no minimum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	199 <param name="max" argument="--maximum-length" type="integer" min="0" optional="True" value="0" label="Maximum length" help="Discard trimmed reads that are longer than LENGTH. Reads that are too long even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no maximum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	200 <param name="max_n" argument="--max-n" type="float" min="0" optional="True" label="Max N" help="Discard reads with more than this number of 'N' bases. A number between 0 and 1 is interpreted as a fraction of the read length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	201 <param name="pair_filter" argument="--pair-filter" type="select" optional="True" label="Pair filter" help="Which of the reads in a paired-end read have to match the filtering criterion in order for the pair to be filtered. Default: any">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	202 <option value="any" selected="True">any</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	203 <option value="both">both</option>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	204 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	205 </section>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	206
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	207 <!-- Read Modification Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	208 <section name="read_mod_options" title="Read Modification Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	209 <param name="quality_cutoff" argument="--quality-cutoff" type="text" value="0" label="Quality cutoff" help=" Trim low-quality bases from 5' and/or 3' ends of each read before adapter removal. Applied to both reads if data is paired. If one value is given, only the 3' end is trimmed. If two comma-separated cutoffs are given, the 5' end is trimmed with the first cutoff, the 3' end with the second.">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	210 <sanitizer>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	211 <valid initial="string.digits"><add value="," /></valid>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	212 </sanitizer>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	213 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	214 <param name="nextseq_trim" argument="--nextseq-trim" type="integer" value="0" label="NextSeq trimming" help="Experimental option for quality trimming of NextSeq data. This is necessary because that machine cannot distinguish between G and reaching the end of the fragment (it encodes G as ‘black’). This option works like regular quality trimming (where one would use -q 20 instead), except that the qualities of G bases are ignored." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	215 <param name="trim_n" argument="--trim-n" type="boolean" truevalue="--trim-n" falsevalue="" checked="False" label="Trim Ns" help="Trim N's on ends of reads." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	216 <param name="prefix" argument="--prefix" label="Prefix" type="text" help="Add this prefix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	217 <param name="suffix" argument="--suffix" label="Suffix" type="text" help="Add this suffix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	218 <param name="strip_suffix" argument="--strip-suffix" label="Strip suffix" type="text" help="Remove this suffix from read names if present." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	219 <param name="length" argument="--length" type="integer" value="0" label="Length" help="Shorten reads to this length. This modification is applied after adapter trimming." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	220 <param name="length_tag" argument="--length-tag" label="Length Tag" type="text" help="Search for TAG followed by a decimal number in the name of the read (description/comment field of the FASTA or FASTQ file). Replace the decimal number with the correct length of the trimmed read. For example, use --length-tag 'length=' to search for fields like 'length=123'." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	221 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	222
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	223 <!-- Output Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	224 <section name="output_options" title="Output Options">
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	225 <param name="report" type="boolean" value="False" label="Report" help="Cutadapt's per-adapter statistics. You can use this file with MultiQC."/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	226 <param name="info_file" argument="--info-file" type="boolean" value="False" label="Info File" help="Write information about each read and its adapter matches to a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	227 <param name="rest_file" argument="--rest-file" type="boolean" value="False" label="Rest of Read" help="When the adapter matches in the middle of a read, write the rest (after the adapter) into a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	228 <param name="wildcard_file" argument="--wildcard-file" type="boolean" value="False" label="Wildcard File" help="When the adapter has wildcard bases ('N's) write adapter bases matching wildcard positions to file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	229 <param name="too_short_file" argument="--too-short-output" type="boolean" value="False" label="Too Short Reads" help="Write reads that are too short (according to minimum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	230 <param name="too_long_file" argument="--too-long-output" type="boolean" value="False" label="Too Long Reads" help="Write reads that are too long (according to maximum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	231 <param name="untrimmed_file" argument="--untrimmed-output" type="boolean" value="False" label="Untrimmed Reads" help="Write reads that do not contain the adapter to a separate file, instead of writing them to the regular output file. (default: output to same file as trimmed)"/>
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	232 <param name="multiple_output" argument="" type="boolean" value="False" label="Multiple output" help="Create a separate file for each adapter trimmed (default: all trimmed reads are in a single file)"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	233 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	234
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	235 </inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	236
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	237 <outputs>
15 660cffd8d92a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 11951898f7d8f09a6ad565128832c7717adb25b2 iuc parents: 14 diff changeset	238 <data name="out1" format="fastqsanger" metadata_source="input_1" from_work_dir="out1*" label="${tool.name} on ${on_string}: Read 1 Output">
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	239 <filter>(output_options['multiple_output'] is False)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	240 <expand macro="inherit_format_1" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	241 </data>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	242 <data name="out2" format="fastqsanger" metadata_source="input_2" from_work_dir="out2*" label="${tool.name} on ${on_string}: Read 2 Output" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	243 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	244 <expand macro="inherit_format_2" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	245 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	246
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	247 <data name="report" format="txt" from_work_dir="report.txt" label="${tool.name} on ${on_string}: Report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	248 <filter>(output_options['report'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	249 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	250
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	251 <data name="info_file" format="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Info File" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	252 <filter>(output_options['info_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	253 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	254
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	255 <data name="rest_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Rest of Reads (R1 only)" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	256 <filter>(output_options['rest_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	257 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	258 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	259
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	260 <data name="wild_output" format="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Wildcard File" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	261 <filter>(output_options['wildcard_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	262 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	263
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	264 <data name="untrimmed_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Untrimmed Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	265 <filter>(output_options['untrimmed_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	266 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	267 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	268 <data name="untrimmed_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Untrimmed Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	269 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	270 <filter>(output_options['untrimmed_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	271 <expand macro="inherit_format_2" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	272 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	273
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	274 <data name="too_short_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Short Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	275 <filter>(output_options['too_short_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	276 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	277 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	278 <data name="too_short_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Short Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	279 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	280 <filter>(output_options['too_short_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	281 <expand macro="inherit_format_2" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	282 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	283
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	284 <data name="too_long_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Long Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	285 <filter>(output_options['too_long_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	286 <expand macro="inherit_format_1" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	287 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	288 <data name="too_long_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Long Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	289 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	290 <filter>(output_options['too_long_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	291 <expand macro="inherit_format_2" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	292 </data>
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	293
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	294 <collection name="split_output" type="list" label="${tool.name} on ${on_string}: Split outputs" >
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	295 <discover_datasets pattern="(?P<designation>.+)\.(?P<ext>fastq.*)" directory="split" />
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	296 <filter>(output_options['multiple_output'] is True)</filter>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	297 </collection>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	298
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	299 </outputs>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	300
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	301 <tests>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	302 <!-- Ensure fastq works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	303 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	304 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	305 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	306 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	307 <param name="adapter" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	308 <output name="out1" file="cutadapt_small.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	309 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	310 <!-- Ensure single end fastq.gz works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	311 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	312 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	313 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	314 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	315 <param name="adapter" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	316 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	317 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	318 <!-- Ensure paired end fastq.gz works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	319 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	320 <param name="type" value="paired" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	321 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	322 <param name="input_2" ftype="fastq.gz" value="bwa-mem-fastq2.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	323 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	324 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	325 <param name="adapter_source_list2" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	326 <param name="adapter2" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	327 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	328 <output name="out2" decompress="True" file="cutadapt_out2.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	329 </test>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	330 <!-- Ensure paired collection works -->
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	331 <test>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	332 <param name="type" value="paired_collection" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	333 <param name="input_1">
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	334 <collection type="paired">
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	335 <element name="forward" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	336 <element name="reverse" ftype="fastq.gz" value="bwa-mem-fastq2.fq.gz" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	337 </collection>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	338 </param>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	339 <param name="adapter_source_list" value="user"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	340 <param name="adapter" value="AGATCGGAAGAGC"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	341 <param name="adapter_source_list2" value="user"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	342 <param name="adapter2" value="AGATCGGAAGAGC"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	343 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	344 <output name="out2" decompress="True" file="cutadapt_out2.fq.gz" ftype="fastq.gz"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	345 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	346 <!-- Ensure built-in adapters work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	347 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	348 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	349 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	350 <param name="adapter_source_list" value="builtin"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	351 <param name="adapter" value="TGTAGGCC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	352 <output name="out1" file="cutadapt_builtin.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	353 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	354 <!-- Ensure discard file output works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	355 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	356 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	357 <param name="adapter_source_list" value="user"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	358 <param name="adapter" value="TTAGACATATCTCCGTCG"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	359 <param name="output_filtering" value="filter"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	360 <param name="discard" value="True"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	361 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	362 <param name="output_type" value="default"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	363 <output name="out1" file="cutadapt_discard.out" ftype="fastq"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	364 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	365 <!-- Ensure rest file output works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	366 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	367 <param name="input_1" ftype="fasta" value="cutadapt_rest.fa" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	368 <param name="adapter_source_list" value="user"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	369 <param name="adapter" value="AAAGATG"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	370 <param name="output_filtering" value="default"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	371 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	372 <param name="output_type" value="additional"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	373 <param name="rest_file" value="True"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	374 <output name="out1" file="cutadapt_rest.out" ftype="fasta"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	375 <output name="rest_output" file="cutadapt_rest2.out" ftype="fasta"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	376 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	377 <!-- Ensure nextseq-trim option works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	378 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	379 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	380 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	381 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	382 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	383 <param name="read_modification" value="modify"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	384 <param name="nextseq_trim" value="20" />
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	385 <output name="out1" decompress="True" file="cutadapt_nextseq_out.fq.gz" ftype="fastq.gz"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	386 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	387 <!-- Ensure Report and Info file output work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	388 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	389 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	390 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	391 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	392 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	393 <param name="report" value="True" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	394 <param name="info_file" value="True" />
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	395 <output name="out1" value="cutadapt_small.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	396 <output name="report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	397 <assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	398 <has_text text="Summary"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	399 </assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	400 </output>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	401 <output name="info_file" value="cutadapt_info_out.txt" ftype="txt"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	402 </test>
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	403
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	404
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	405 <test>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	406 <conditional name="library">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	407 <param name="type" value="single" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	408 <param name="input_1" ftype="fastq" value="cutadapt_in_split.fastq" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	409 <section name="r1" >
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	410 <repeat name="front_adapters">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	411 <conditional name="front_adapter_source">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	412 <param name="front_adapter_source_list" value="user"/>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	413 <param name="front_adapter_name" value="A1" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	414 <param name="front_adapter" value="^GTCGGTAA" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	415 </conditional>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	416 </repeat>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	417 <repeat name="front_adapters">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	418 <conditional name="front_adapter_source">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	419 <param name="front_adapter_source_list" value="user"/>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	420 <param name="front_adapter_name" value="A2" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	421 <param name="front_adapter" value="^AGGTCACT" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	422 </conditional>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	423 </repeat>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	424 </section>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	425 </conditional>
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	426 <param name="report" value="False" />
16 8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	427 <param name="info_file" value="False" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	428 <param name="multiple_output" value="True" />
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	429 <output_collection name="split_output" type="list" count="3">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	430 <element name="A1" value="A1.fastq" ftype="fastq">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	431 </element>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	432 <element name="A2" value="A2.fastq" ftype="fastq">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	433 </element>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	434 <element name="unknown" value="unknown.fastq" ftype="fastq">
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	435 </element>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	436 </output_collection>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	437 </test>
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	438
8f1df515eb87 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 034c93600ce3279644d05f3675b4820ef7180851 iuc parents: 15 diff changeset	439
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	440 <test>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	441 <conditional name="library">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	442 <param name="type" value="single" />
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	443 <param name="input_1" ftype="fastq.gz" value="cutadapt_in_split.fastq.gz" />
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	444 <section name="r1" >
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	445 <repeat name="front_adapters">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	446 <conditional name="front_adapter_source">
19 49370cb85f0f planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 6318c53e772ed592862729f3048ed9bd3a711969 iuc parents: 18 diff changeset	447 <param name="front_adapter_source_list" value="file"/>
49370cb85f0f planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 6318c53e772ed592862729f3048ed9bd3a711969 iuc parents: 18 diff changeset	448 <param name="front_adapter_file" ftype="fasta" value="barcodes.fasta" />
18 5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	449 </conditional>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	450 </repeat>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	451 </section>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	452 </conditional>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	453 <param name="report" value="False" />
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	454 <param name="info_file" value="False" />
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	455 <param name="multiple_output" value="True" />
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	456 <output_collection name="split_output" type="list" count="3">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	457 <element name="A1" decompress="True" file="A1.fastq.gz" ftype="fastq.gz">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	458 </element>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	459 <element name="A2" decompress="True" file="A2.fastq.gz" ftype="fastq.gz">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	460 </element>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	461 <element name="unknown" decompress="True" file="unknown.fastq.gz" ftype="fastq.gz">
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	462 </element>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	463 </output_collection>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	464 </test>
5c7e7d905b33 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit b58d6ff959a1d920fd0d9b02e43d2482667d61e8 iuc parents: 17 diff changeset	465
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	466 </tests>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	467
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	468 <help><![CDATA[
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	469
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	470 .. class:: infomark
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	471
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	472 What it does
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	473
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	474 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	475
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	476 Cutadapt finds and removes adapter sequences, primers, poly-A tails and other types of unwanted sequence from your high-throughput sequencing reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	477
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	478 Cleaning your data in this way is often required: Reads from small-RNA sequencing contain the 3’ sequencing adapter because the read is longer than the molecule that is sequenced, such as in microRNA, or CRISPR data, or Poly-A tails that are useful for pulling out RNA from your sample but often you don’t want them to be in your reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	479
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	480 Cutadapt_ helps with these trimming tasks by finding the adapter or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with options in the tool form above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	481
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	482 The tool is based on the Open Source Cutadapt_ tool. See the complete `Cutadapt documentation`_ for additional details. If you use Cutadapt, please cite Marcel, 2011 under Citations below.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	483
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	484 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	485
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	486 Inputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	487
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	488 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	489
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	490 Input files for Cutadapt need to be:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	491
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	492 - FASTQ.GZ, FASTQ.BZ2, FASTQ or FASTA
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	493
19 49370cb85f0f planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 6318c53e772ed592862729f3048ed9bd3a711969 iuc parents: 18 diff changeset	494 To trim an adapter, input the ADAPTER sequence in plain text or in a FASTA file e.g. AACCGGTT (with the characters: $, ^, ..., if anchored or linked).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	495
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	496 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	497 Option Sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	498 --------------------------------------------- -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	499 3’ (End) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	500 Anchored 3’ Adapter ADAPTER$
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	501
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	502 5’ (Front) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	503 Anchored 5’ Adapter ^ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	504
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	505 5’ or 3’ (Both possible) ADAPTER
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	506
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	507 Linked Adapter - 3' (End) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	508 Non-anchored Linked Adapter - 5' (Front) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	509 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	510
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	511 Below is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	512
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	513 .. image:: $PATH_TO_IMAGES/adapters.svg
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	514
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	515
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	516 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	517
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	518 Example: Illumina TruSeq Adapters
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	519
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	520 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	521
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	522 If you have reads containing Illumina TruSeq adapters, for example, follow these steps.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	523
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	524
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	525 For Single-end reads as well as the first reads of Paired-end data:
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	526
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	527 Read 1
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	528
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	529 In the 3' (End) Adapters option above, insert A + the “TruSeq Indexed Adapter” prefix that is common to all Indexed Adapter sequences, e.g insert:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	530
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	531 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	532
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	533
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	534 For the second reads of Paired-end data:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	535
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	536 Read 2
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	537
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	538 In the 3' (End) Adapters option above, insert the reverse complement of the “TruSeq Universal Adapter”:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	539
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	540 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	541
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	542 The adapter sequences can be found in the document `Illumina TruSeq Adapters De-Mystified`_.
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	543
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	544 -----------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	545
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	546 Outputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	547
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	548 -----------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	549
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	550 - Trimmed reads
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	551
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	552 Optionally, under Output Options you can choose to output
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	553
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	554 * Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	555 * Info file
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	556
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	557
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	558 Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	559
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	560 Cutadapt can output per-adapter statistics if you select to output the report above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	561
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	562 Example:
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	563
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	564 This is cutadapt 1.16 with Python 3.6.4
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	565
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	566 Command line parameters: -j 1 --format=fastq -a AGATCGGAAGAGC --info-file=/tmp/tmpX0DlY1/files/000/dataset_21.dat --output=out1.fq --error-rate=0.1 --times=1 --overlap=3 input_f.fastq
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	567 Running on 1 core
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	568 Trimming 1 adapter with at most 10.0% errors in single-end mode ...
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	569 Finished in 0.00 s (1426 us/read; 0.04 M reads/minute).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	570
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	571 === Summary ===
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	572
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	573 * Total reads processed: 3*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	574 * Reads with adapters: 0 (0.0%)*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	575 * Reads written (passing filters): 3 (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	576
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	577 * Total basepairs processed: 102 bp*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	578 * Total written (filtered): 102 bp (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	579
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	580 === Adapter 1 ===
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	581
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	582 Sequence: AGATCGGAAGAGC; Type: regular 3'; Length: 13; Trimmed: 0 times.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	583
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	584
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	585 Info file
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	586
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	587 The info file contains information about the found adapters. The output is a tab-separated text file. Each line corresponds to one read of the input file.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	588
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	589 Columns contain the following data:
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	590
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	591 * 1st: Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	592 * 2nd: Number of errors
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	593 * 3rd: 0-based start coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	594 * 4th: 0-based end coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	595 * 5th: Sequence of the read to the left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	596 * 6th: Sequence of the read that was matched to the adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	597 * 7th: Sequence of the read to the right of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	598 * 8th: Name of the found adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	599 * 9th: Quality values corresponding to sequence left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	600 * 10th: Quality values corresponding to sequence matched to the adapter (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	601 * 11th: Quality values corresponding to sequence to the right of the adapter (can be empty)
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	602
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	603 The concatenation of columns 5-7 yields the full read sequence. Column 8 identifies the found adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	604
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	605 If no adapter was found, the format is as follows:
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	606
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	607 #. Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	608 #. The value -1
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	609 #. The read sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	610 #. Quality values
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	611
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	612 When parsing the file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	613
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	614 If the --times option is used and greater than 1, each read can appear more than once in the info file. There will be one line for each found adapter, all with identical read names. Only for the first of those lines will the concatenation of columns 5-7 be identical to the original read sequence (and accordingly for columns 9-11). For subsequent lines, the shown sequence are the ones that were used in subsequent rounds of adapter trimming, that is, they get successively shorter.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	615
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	616 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	617
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	618 More Information
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	619
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	620 --------------------
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	621
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	622 See the excellent `Cutadapt documentation`_
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	623
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	624 .. _Cutadapt: https://cutadapt.readthedocs.io/en/stable/
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	625 .. _`Cutadapt documentation`: https://cutadapt.readthedocs.io/en/latest/index.html
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	626 .. _`Illumina TruSeq Adapters De-Mystified`: http://tucf-genomics.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	627
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	628
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	629 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	630
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	631 Galaxy Wrapper Development
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	632
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	633 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	634
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	635 Author: Lance Parsons <lparsons@princeton.edu>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	636
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	637 ]]></help>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	638
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	639 <citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	640 <citation type="bibtex">
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	641 @article{marcel_cutadapt_2011,
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	642 title = {Cutadapt removes adapter sequences from high-throughput sequencing reads},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	643 volume = {17},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	644 copyright = {Authors who publish with this journal agree to the following terms: Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work's authorship and initial publication in this journal. Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal. Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work (See The Effect of Open Access ).},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	645 url = {http://journal.embnet.org/index.php/embnetjournal/article/view/200},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	646 abstract = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features.
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	647
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	648 Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	649 number = {1},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	650 urldate = {2011-08-02},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	651 journal = {EMBnet.journal},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	652 author = {Marcel, Martin},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	653 year = {2011},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	654 note = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features. Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	655 keywords = {Adapter removal;, fastq, MicroRNA, Sequencing, Small RNA, software},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	656 file = {Cutadapt removes adapter sequences from high-throughput sequencing reads \| Martin \| EMBnet.journal:/Users/lparsons/Library/Application Support/Firefox/Profiles/thd2t4je.default/zotero/storage/ZXZT4PSE/200.html:text/html}
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	657 }
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	658 </citation>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	659 </citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	660
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	661 </tool>

Mercurial > repos > lparsons > cutadapt

annotate cutadapt.xml @ 19:49370cb85f0f draft