cutadapt: cutadapt.xml annotate

annotate cutadapt.xml @ 12:78e1cf88d133 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488

author	iuc
date	Thu, 24 May 2018 18:24:08 -0400
parents	8665bcc8b847
children	f5fdf41c08b8

rev	line source
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	1 <tool id="cutadapt" name="Cutadapt" version="1.16.1" profile="17.09">
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	2 <description>Remove adapter sequences from Fastq/Fasta</description>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	3 <macros>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	4 <import>macros.xml</import>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	5 </macros>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	6 <requirements>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	7 <requirement type="package" version="1.16">cutadapt</requirement>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	8 </requirements>
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	9
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	10 <version_command>cutadapt --version</version_command>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	11
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	12 <command detect_errors="exit_code"><![CDATA[
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	13
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	14 ## Link in the input and output files, so Cutadapt can tell their type
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	15
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	16 #import re
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	17 #set format = "fastq"
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	18 #set read1 = "input_f"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	19 #set read2 = "input_r"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	20 #set paired = False
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	21 #set library_type = str($library.type)
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	22 #if $library_type == 'paired':
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	23 #set paired = True
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	24 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.element_identifier))
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	25 #set read2 = re.sub('[^\w\-\s]', '_', str($library.input_2.element_identifier))
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	26 #set input_1 = $library.input_1
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	27 #set input_2 = $library.input_2
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	28 #else if $library_type == 'paired_collection'
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	29 #set paired = True
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	30 #set input_1 = $library.input_1.forward
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	31 #set input_2 = $library.input_1.reverse
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	32 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.name))
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	33 #else
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	34 #set input_1 = $library.input_1
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	35 #set read1 = re.sub('[^\w\-\s]', '_', str($library.input_1.element_identifier))
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	36 #end if
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	37
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	38 #if $input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	39 #set read1 = $read1 + ".fq.gz"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	40 #set out1 = "out1.gz"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	41 #else if $input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	42 #set read1 = $read1 + ".fq.bz2"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	43 #set out1 = "out1.bz2"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	44 #else if $input_1.is_of_type('fasta'):
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	45 #set format = "fasta"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	46 #set read1 = $read1 + ".fa"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	47 #set out1 = "out1.fa"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	48 #else:
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	49 #set read1 = $read1 + ".fq"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	50 #set out1 = "out1.fq"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	51 #end if
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	52 ln -f -s '${input_1}' '$read1' &&
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	53
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	54 #if $paired:
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	55 #if $input_2.is_of_type("fastq.gz", "fastqsanger.gz"):
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	56 #set read2 = $read2 + ".fq.gz"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	57 #set out2 = "out2.gz"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	58 #else if $input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	59 #set read2 = $read2 + ".fq.bz2"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	60 #set out2 = "out2.bz2"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	61 #else if $input_2.is_of_type('fasta'):
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	62 #set format = "fasta"
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	63 #set read2 = $read2 + ".fa"
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	64 #set out2 = "out2.fa"
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	65 #else:
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	66 #set read2 = $read2 + ".fq"
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	67 #set out2 = "out2.fq"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	68 #end if
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	69 ln -f -s '${input_2}' '$read2' &&
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	70 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	71
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	72 ## Run Cutadapt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	73
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	74 cutadapt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	75
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	76 -j \${GALAXY_SLOTS:-4}
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	77
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	78 --format=$format
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	79
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	80 #if str( $library.type ) == "single":
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	81 @read1_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	82 --output='$out1'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	83 #else:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	84 @read1_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	85 @read2_options@
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	86 --output='$out1'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	87 --paired-output='$out2'
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	88 #end if
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	89
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	90 --error-rate=$adapter_options.error_rate
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	91 --times=$adapter_options.count
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	92 --overlap=$adapter_options.overlap
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	93 $adapter_options.no_indels
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	94 $adapter_options.match_read_wildcards
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	95
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	96
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	97 $filter_options.discard
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	98 $filter_options.discard_untrimmed
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	99 $filter_options.no_trim
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	100 $filter_options.mask_adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	101 #if str($filter_options.min) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	102 --minimum-length=$filter_options.min
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	103 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	104 #if str($filter_options.max) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	105 --maximum-length=$filter_options.max
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	106 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	107 #if $filter_options.max_n:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	108 --max-n=$filter_options.max_n
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	109 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	110 #if str( $library.type ) != "single":
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	111 #if $filter_options.pair_filter:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	112 --pair-filter=$filter_options.pair_filter
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	113 #end if
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	114 #end if
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	115
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	116
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	117 #if str($read_mod_options.quality_cutoff) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	118 --quality-cutoff=$read_mod_options.quality_cutoff
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	119 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	120 #if str($read_mod_options.nextseq_trim) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	121 --nextseq-trim=$read_mod_options.nextseq_trim
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	122 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	123 $read_mod_options.trim_n
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	124 #if $read_mod_options.prefix != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	125 --prefix="$read_mod_options.prefix"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	126 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	127 #if $read_mod_options.suffix != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	128 --suffix="$read_mod_options.suffix"
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	129 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	130 #if str($read_mod_options.length) != '0':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	131 --length=$$read_mod_options.length
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	132 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	133 #if $read_mod_options.length_tag != '':
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	134 --length-tag="$read_mod_options.length_tag"
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	135 #end if
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	136
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	137 '${read1}'
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	138 #if $paired:
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	139 '${read2}'
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	140 #end if
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	141
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	142 #if $output_options.report:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	143 > report.txt
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	144 #end if
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	145 ]]></command>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	146 <inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	147
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	148 <!-- Reads -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	149 <conditional name="library">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	150 <param name="type" type="select" label="Single-end or Paired-end reads?">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	151 <option value="single">Single-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	152 <option value="paired">Paired-end</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	153 <option value="paired_collection">Paired-end Collection</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	154 </param>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	155
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	156 <when value="single">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	157 <param name="input_1" format="fastq.gz,fastq,fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	158 <expand macro="single_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	159 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	160
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	161 <when value="paired">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	162 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #1" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	163 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data" label="FASTQ/A file #2" help="Should be of datatype "fastq.gz"or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	164 <expand macro="paired_end_options" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	165 </when>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	166
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	167 <when value="paired_collection">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	168 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2,fasta" type="data_collection" collection_type="paired" label="Paired Collection" help="Should be of datatype "fastq.gz" or "fasta"" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	169 <expand macro="paired_end_options" />
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	170 </when>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	171
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	172 </conditional>
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	173
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	174 <!-- Adapter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	175 <section name="adapter_options" title="Adapter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	176 <param name="error_rate" argument="--error-rate" type="float" min="0" max="1" value="0.1" label="Maximum error rate" help="Maximum allowed error rate (no. of errors divided by the length of the matching region)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	177 <param name="no_indels" argument="--no-indels" type="boolean" value="False" truevalue="--no-indels" falsevalue="" label="Do not allow indels (Use ONLY with anchored 5' (front) adapters)." help="Do not allow indels in the alignments. That is, allow only mismatches. This option is currently only supported for anchored 5' adapters ('^ADAPTER') (default: both mismatches and indels are allowed)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	178 <param name="count" argument="--times" type="integer" min="1" value="1" label="Match times" help="Try to remove adapters at most COUNT times. Useful when an adapter gets appended multiple times." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	179 <param name="overlap" argument="--overlap" type="integer" min="1" value="3" label="Minimum overlap length" help="Minimum overlap length. If the overlap between the adapter and the sequence is shorter than LENGTH, the read is not modified. This reduces the number of bases trimmed purely due to short random adapter matches." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	180 <param name="match_read_wildcards" argument="--match-read-wildcards" type="boolean" value="False" truevalue="--match-read-wildcards" falsevalue="" label="Match Read Wildcards" help="Allow 'N's in the read as matches to the adapter." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	181 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	182
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	183 <!-- Filter Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	184 <section name="filter_options" title="Filter Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	185 <param name="discard" argument="--discard-trimmed" type="boolean" value="False" truevalue="--discard" falsevalue="" label="Discard Trimmed Reads" help="Discard reads that contain the adapter instead of trimming them. Use the 'Minimum overlap length' option in order to avoid throwing away too many randomly matching reads!" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	186 <param name="discard_untrimmed" argument="--discard_untrimmed" type="boolean" value="False" truevalue="--discard-untrimmed" falsevalue="" label="Discard Untrimmed Reads" help="Discard reads that do not contain the adapter." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	187 <param name="min" argument="--minimum-length" type="integer" min="0" optional="True" value="0" label="Minimum length" help="Discard trimmed reads that are shorter than LENGTH. Reads that are too short even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no minimum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	188 <param name="max" argument="--maximum-length" type="integer" min="0" optional="True" value="0" label="Maximum length" help="Discard trimmed reads that are longer than LENGTH. Reads that are too long even before adapter removal are also discarded. In colorspace, an initial primer is not counted. Value of 0 means no maximum length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	189 <param name="no_trim" argument="--no-trim" type="boolean" value="False" truevalue="--no-trim" falsevalue="" label="Do not trim adapters" help="Match and redirect reads to output/untrimmed-output as usual, but don't remove the adapters (default: trim the adapters)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	190 <param name="mask_adapter" argument="--mask-adapter" type="boolean" value="False" truevalue="--mask-adapter" falsevalue="" label="Mask Adapters" help="Mask adapter bases with 'N' instead of trimming them (default: trim adapters)." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	191 <param name="max_n" argument="--max-n" type="float" min="0" optional="True" label="Max N" help="Discard reads with more than this number of 'N' bases. A number between 0 and 1 is interpreted as a fraction of the read length." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	192 <param name="pair_filter" argument="--pair-filter" type="select" optional="True" label="Pair filter" help="Which of the reads in a paired-end read have to match the filtering criterion in order for the pair to be filtered. Default: any">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	193 <option value="any" selected="True">any</option>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	194 <option value="both">both</option>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	195 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	196 </section>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	197
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	198 <!-- Read Modification Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	199 <section name="read_mod_options" title="Read Modification Options">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	200 <param name="quality_cutoff" argument="--quality-cutoff" type="text" value="0" label="Quality cutoff" help=" Trim low-quality bases from 5' and/or 3' ends of each read before adapter removal. Applied to both reads if data is paired. If one value is given, only the 3' end is trimmed. If two comma-separated cutoffs are given, the 5' end is trimmed with the first cutoff, the 3' end with the second.">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	201 <sanitizer>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	202 <valid initial="string.digits"><add value="," /></valid>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	203 </sanitizer>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	204 </param>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	205 <param name="nextseq_trim" argument="--nextseq-trim" type="integer" value="0" label="NextSeq trimming" help="Experimental option for quality trimming of NextSeq data. This is necessary because that machine cannot distinguish between G and reaching the end of the fragment (it encodes G as ‘black’). This option works like regular quality trimming (where one would use -q 20 instead), except that the qualities of G bases are ignored." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	206 <param name="trim_n" argument="--trim-n" type="boolean" truevalue="--trim-n" falsevalue="" checked="False" label="Trim Ns" help="Trim N's on ends of reads." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	207 <param name="prefix" argument="--prefix" label="Prefix" type="text" help="Add this prefix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	208 <param name="suffix" argument="--suffix" label="Suffix" type="text" help="Add this suffix to read names" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	209 <param name="strip_suffix" argument="--strip-suffix" label="Strip suffix" type="text" help="Remove this suffix from read names if present." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	210 <param name="length" argument="--length" type="integer" value="0" label="Length" help="Shorten reads to this length. This modification is applied after adapter trimming." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	211 <param name="length_tag" argument="--length-tag" label="Length Tag" type="text" help="Search for TAG followed by a decimal number in the name of the read (description/comment field of the FASTA or FASTQ file). Replace the decimal number with the correct length of the trimmed read. For example, use --length-tag 'length=' to search for fields like 'length=123'." />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	212 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	213
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	214 <!-- Output Options -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	215 <section name="output_options" title="Output Options">
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	216 <param name="report" type="boolean" value="False" label="Report" help="Cutadapt's per-adapter statistics. You can use this file with MultiQC."/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	217 <param name="info_file" argument="--info-file" type="boolean" value="False" label="Info File" help="Write information about each read and its adapter matches to a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	218 <param name="rest_file" argument="--rest-file" type="boolean" value="False" label="Rest of Read" help="When the adapter matches in the middle of a read, write the rest (after the adapter) into a file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	219 <param name="wildcard_file" argument="--wildcard-file" type="boolean" value="False" label="Wildcard File" help="When the adapter has wildcard bases ('N's) write adapter bases matching wildcard positions to file."/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	220 <param name="too_short_file" argument="--too-short-output" type="boolean" value="False" label="Too Short Reads" help="Write reads that are too short (according to minimum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	221 <param name="too_long_file" argument="--too-long-output" type="boolean" value="False" label="Too Long Reads" help="Write reads that are too long (according to maximum length specified) to a file. (default: discard reads)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	222 <param name="untrimmed_file" argument="--untrimmed-output" type="boolean" value="False" label="Untrimmed Reads" help="Write reads that do not contain the adapter to a separate file, instead of writing them to the regular output file. (default: output to same file as trimmed)"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	223 </section>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	224
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	225 </inputs>
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	226
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	227 <outputs>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	228 <data name="out1" format="fasta" metadata_source="input_1" from_work_dir="out1*" label="${tool.name} on ${on_string}: Read 1 Output">
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	229 <expand macro="inherit_format_1" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	230 </data>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	231 <data name="out2" format="fastqsanger" metadata_source="input_2" from_work_dir="out2*" label="${tool.name} on ${on_string}: Read 2 Output" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	232 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	233 <expand macro="inherit_format_2" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	234 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	235
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	236 <data name="report" format="txt" from_work_dir="report.txt" label="${tool.name} on ${on_string}: Report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	237 <filter>(output_options['report'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	238 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	239
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	240 <data name="info_file" format="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Info File" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	241 <filter>(output_options['info_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	242 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	243
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	244 <data name="rest_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Rest of Reads (R1 only)" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	245 <filter>(output_options['rest_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	246 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	247 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	248
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	249 <data name="wild_output" format="txt" metadata_source="input_1" label="${tool.name} on ${on_string}: Wildcard File" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	250 <filter>(output_options['wildcard_file'] is True)</filter>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	251 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	252
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	253 <data name="untrimmed_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Untrimmed Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	254 <filter>(output_options['untrimmed_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	255 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	256 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	257 <data name="untrimmed_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Untrimmed Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	258 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	259 <filter>(output_options['untrimmed_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	260 <expand macro="inherit_format_2" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	261 </data>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	262
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	263 <data name="too_short_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Short Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	264 <filter>(output_options['too_short_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	265 <expand macro="inherit_format_1" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	266 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	267 <data name="too_short_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Short Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	268 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	269 <filter>(output_options['too_short_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	270 <expand macro="inherit_format_2" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	271 </data>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	272
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	273 <data name="too_long_output" format="fastqsanger" metadata_source="input_1" label="${tool.name} on ${on_string}: Too Long Read 1" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	274 <filter>(output_options['too_long_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	275 <expand macro="inherit_format_1" />
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	276 </data>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	277 <data name="too_long_paired_output" format="fastqsanger" metadata_source="input_2" label="${tool.name} on ${on_string}: Too Long Read 2" >
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	278 <filter>(library['type'] == 'paired' or library['type'] == 'paired_collection')</filter>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	279 <filter>(output_options['too_long_file'] is True)</filter>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	280 <expand macro="inherit_format_2" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	281 </data>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	282 </outputs>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	283
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	284 <tests>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	285 <!-- Ensure fastq works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	286 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	287 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	288 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	289 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	290 <param name="adapter" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	291 <output name="out1" file="cutadapt_small.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	292 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	293 <!-- Ensure single end fastq.gz works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	294 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	295 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	296 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	297 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	298 <param name="adapter" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	299 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	300 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	301 <!-- Ensure paired end fastq.gz works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	302 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	303 <param name="type" value="paired" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	304 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	305 <param name="input_2" ftype="fastq.gz" value="bwa-mem-fastq2.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	306 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	307 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	308 <param name="adapter_source_list2" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	309 <param name="adapter2" value="AGATCGGAAGAGC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	310 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	311 <output name="out2" decompress="True" file="cutadapt_out2.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	312 </test>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	313 <!-- Ensure paired collection works -->
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	314 <test>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	315 <param name="type" value="paired_collection" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	316 <param name="input_1">
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	317 <collection type="paired">
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	318 <element name="forward" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	319 <element name="reverse" ftype="fastq.gz" value="bwa-mem-fastq2.fq.gz" />
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	320 </collection>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	321 </param>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	322 <param name="adapter_source_list" value="user"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	323 <param name="adapter" value="AGATCGGAAGAGC"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	324 <param name="adapter_source_list2" value="user"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	325 <param name="adapter2" value="AGATCGGAAGAGC"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	326 <output name="out1" decompress="True" file="cutadapt_out1.fq.gz" ftype="fastq.gz"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	327 <output name="out2" decompress="True" file="cutadapt_out2.fq.gz" ftype="fastq.gz"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	328 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	329 <!-- Ensure built-in adapters work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	330 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	331 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	332 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	333 <param name="adapter_source_list" value="builtin"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	334 <param name="adapter" value="TGTAGGCC"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	335 <output name="out1" file="cutadapt_builtin.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	336 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	337 <!-- Ensure discard file output works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	338 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	339 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	340 <param name="adapter_source_list" value="user"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	341 <param name="adapter" value="TTAGACATATCTCCGTCG"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	342 <param name="output_filtering" value="filter"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	343 <param name="discard" value="True"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	344 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	345 <param name="output_type" value="default"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	346 <output name="out1" file="cutadapt_discard.out" ftype="fastq"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	347 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	348 <!-- Ensure rest file output works -->
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	349 <test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	350 <param name="input_1" ftype="fasta" value="cutadapt_rest.fa" />
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	351 <param name="adapter_source_list" value="user"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	352 <param name="adapter" value="AAAGATG"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	353 <param name="output_filtering" value="default"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	354 <param name="read_modification" value="none"/>
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	355 <param name="output_type" value="additional"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	356 <param name="rest_file" value="True"/>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	357 <output name="out1" file="cutadapt_rest.out" ftype="fasta"/>
78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	358 <output name="rest_output" file="cutadapt_rest2.out" ftype="fasta"/>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	359 </test>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	360 <!-- Ensure nextseq-trim option works -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	361 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	362 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	363 <param name="input_1" ftype="fastq.gz" value="bwa-mem-fastq1.fq.gz" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	364 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	365 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	366 <param name="read_modification" value="modify"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	367 <param name="nextseq_trim" value="20" />
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	368 <output name="out1" decompress="True" file="cutadapt_nextseq_out.fq.gz" ftype="fastq.gz"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	369 </test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	370 <!-- Ensure Report and Info file output work -->
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	371 <test>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	372 <param name="type" value="single" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	373 <param name="input_1" ftype="fastq" value="cutadapt_small.fastq" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	374 <param name="adapter_source_list" value="user"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	375 <param name="adapter" value="AGATCGGAAGAGC"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	376 <param name="report" value="True" />
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	377 <param name="info_file" value="True" />
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	378 <output name="out1" value="cutadapt_small.out" ftype="fastq"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	379 <output name="report">
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	380 <assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	381 <has_text text="Summary"/>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	382 </assert_contents>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	383 </output>
12 78e1cf88d133 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 195c6112eff237b20a6744e82e2c4e7641f7c488 iuc parents: 11 diff changeset	384 <output name="info_file" value="cutadapt_info_out.txt" ftype="txt"/>
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	385 </test>
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	386 </tests>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	387
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	388 <help><![CDATA[
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	389
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	390 .. class:: infomark
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	391
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	392 What it does
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	393
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	394 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	395
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	396 Cutadapt finds and removes adapter sequences, primers, poly-A tails and other types of unwanted sequence from your high-throughput sequencing reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	397
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	398 Cleaning your data in this way is often required: Reads from small-RNA sequencing contain the 3’ sequencing adapter because the read is longer than the molecule that is sequenced, such as in microRNA, or CRISPR data, or Poly-A tails that are useful for pulling out RNA from your sample but often you don’t want them to be in your reads.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	399
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	400 Cutadapt_ helps with these trimming tasks by finding the adapter or primer sequences in an error-tolerant way. It can also modify and filter reads in various ways. Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with options in the tool form above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	401
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	402 The tool is based on the Open Source Cutadapt_ tool. See the complete `Cutadapt documentation`_ for additional details. If you use Cutadapt, please cite Marcel, 2011 under Citations below.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	403
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	404 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	405
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	406 Inputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	407
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	408 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	409
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	410 Input files for Cutadapt need to be:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	411
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	412 - FASTQ.GZ, FASTQ.BZ2, FASTQ or FASTA
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	413
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	414 To trim an adapter, input the ADAPTER sequence e.g. AACCGGTT (with the characters: $, ^, ..., if anchored or linked).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	415
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	416 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	417 Option Sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	418 --------------------------------------------- -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	419 3’ (End) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	420 Anchored 3’ Adapter ADAPTER$
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	421
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	422 5’ (Front) Adapter ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	423 Anchored 5’ Adapter ^ADAPTER
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	424
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	425 5’ or 3’ (Both possible) ADAPTER
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	426
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	427 Linked Adapter - 3' (End) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	428 Non-anchored Linked Adapter - 5' (Front) only ADAPTER1...ADAPTER2
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	429 ============================================= ===================
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	430
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	431 Below is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	432
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	433 .. image:: $PATH_TO_IMAGES/adapters.svg
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	434
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	435
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	436 -------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	437
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	438 Example: Illumina TruSeq Adapters
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	439
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	440 -------------------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	441
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	442 If you have reads containing Illumina TruSeq adapters, for example, follow these steps.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	443
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	444
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	445 For Single-end reads as well as the first reads of Paired-end data:
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	446
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	447 Read 1
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	448
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	449 In the 3' (End) Adapters option above, insert A + the “TruSeq Indexed Adapter” prefix that is common to all Indexed Adapter sequences, e.g insert:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	450
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	451 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	452
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	453
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	454 For the second reads of Paired-end data:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	455
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	456 Read 2
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	457
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	458 In the 3' (End) Adapters option above, insert the reverse complement of the “TruSeq Universal Adapter”:
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	459
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	460 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	461
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	462 The adapter sequences can be found in the document `Illumina TruSeq Adapters De-Mystified`_.
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	463
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	464 -----------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	465
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	466 Outputs
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	467
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	468 -----------
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	469
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	470 - Trimmed reads
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	471
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	472 Optionally, under Output Options you can choose to output
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	473
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	474 * Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	475 * Info file
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	476
2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	477
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	478 Report
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	479
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	480 Cutadapt can output per-adapter statistics if you select to output the report above.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	481
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	482 Example:
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	483
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	484 This is cutadapt 1.16 with Python 3.6.4
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	485
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	486 Command line parameters: -j 1 --format=fastq -a AGATCGGAAGAGC --info-file=/tmp/tmpX0DlY1/files/000/dataset_21.dat --output=out1.fq --error-rate=0.1 --times=1 --overlap=3 input_f.fastq
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	487 Running on 1 core
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	488 Trimming 1 adapter with at most 10.0% errors in single-end mode ...
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	489 Finished in 0.00 s (1426 us/read; 0.04 M reads/minute).
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	490
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	491 === Summary ===
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	492
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	493 * Total reads processed: 3*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	494 * Reads with adapters: 0 (0.0%)*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	495 * Reads written (passing filters): 3 (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	496
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	497 * Total basepairs processed: 102 bp*
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	498 * Total written (filtered): 102 bp (100.0%)*
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	499
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	500 === Adapter 1 ===
8 2d6671b10919 Updated to support cutadapt version 1.1 (also include automatic dependency installation) lparsons parents: 5 diff changeset	501
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	502 Sequence: AGATCGGAAGAGC; Type: regular 3'; Length: 13; Trimmed: 0 times.
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	503
8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	504
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	505 Info file
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	506
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	507 The info file contains information about the found adapters. The output is a tab-separated text file. Each line corresponds to one read of the input file.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	508
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	509 Columns contain the following data:
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	510
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	511 * 1st: Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	512 * 2nd: Number of errors
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	513 * 3rd: 0-based start coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	514 * 4th: 0-based end coordinate of the adapter match
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	515 * 5th: Sequence of the read to the left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	516 * 6th: Sequence of the read that was matched to the adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	517 * 7th: Sequence of the read to the right of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	518 * 8th: Name of the found adapter
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	519 * 9th: Quality values corresponding to sequence left of the adapter match (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	520 * 10th: Quality values corresponding to sequence matched to the adapter (can be empty)
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	521 * 11th: Quality values corresponding to sequence to the right of the adapter (can be empty)
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	522
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	523 The concatenation of columns 5-7 yields the full read sequence. Column 8 identifies the found adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	524
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	525 If no adapter was found, the format is as follows:
93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	526
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	527 #. Read name
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	528 #. The value -1
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	529 #. The read sequence
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	530 #. Quality values
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	531
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	532 When parsing the file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	533
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	534 If the --times option is used and greater than 1, each read can appear more than once in the info file. There will be one line for each found adapter, all with identical read names. Only for the first of those lines will the concatenation of columns 5-7 be identical to the original read sequence (and accordingly for columns 9-11). For subsequent lines, the shown sequence are the ones that were used in subsequent rounds of adapter trimming, that is, they get successively shorter.
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	535
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	536 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	537
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	538 More Information
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	539
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	540 --------------------
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	541
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	542 See the excellent `Cutadapt documentation`_
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	543
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	544 .. _Cutadapt: https://cutadapt.readthedocs.io/en/stable/
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	545 .. _`Cutadapt documentation`: https://cutadapt.readthedocs.io/en/latest/index.html
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	546 .. _`Illumina TruSeq Adapters De-Mystified`: http://tucf-genomics.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	547
9 93d58ffe39f1 Updated to version 1.6 lparsons parents: 8 diff changeset	548
11 8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	549 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	550
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	551 Galaxy Wrapper Development
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	552
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	553 --------------------
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	554
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	555 Author: Lance Parsons <lparsons@princeton.edu>
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	556
8665bcc8b847 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cutadapt commit 07c4e473990f522bbe8254ddeded47ed5f3b2fe4 iuc parents: 10 diff changeset	557 ]]></help>
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	558
10 01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	559 <citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	560 <citation type="bibtex">
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	561 @article{marcel_cutadapt_2011,
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	562 title = {Cutadapt removes adapter sequences from high-throughput sequencing reads},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	563 volume = {17},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	564 copyright = {Authors who publish with this journal agree to the following terms: Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work's authorship and initial publication in this journal. Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal. Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work (See The Effect of Open Access ).},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	565 url = {http://journal.embnet.org/index.php/embnetjournal/article/view/200},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	566 abstract = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features.
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	567
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	568 Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	569 number = {1},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	570 urldate = {2011-08-02},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	571 journal = {EMBnet.journal},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	572 author = {Marcel, Martin},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	573 year = {2011},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	574 note = {When small RNA is sequenced on current sequencing machines, the resulting reads are usually longer than the RNA and therefore contain parts of the 3' adapter. That adapter must be found and removed error-tolerantly from each read before read mapping. Previous solutions are either hard to use or do not offer required features, in particular support for color space data. As an easy to use alternative, we developed the command-line tool cutadapt, which supports 454, Illumina and SOLiD (color space) data, offers two adapter trimming algorithms, and has other useful features. Cutadapt, including its MIT-licensed source code, is available for download at http://code.google.com/p/cutadapt/},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	575 keywords = {Adapter removal;, fastq, MicroRNA, Sequencing, Small RNA, software},
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	576 file = {Cutadapt removes adapter sequences from high-throughput sequencing reads \| Martin \| EMBnet.journal:/Users/lparsons/Library/Application Support/Firefox/Profiles/thd2t4je.default/zotero/storage/ZXZT4PSE/200.html:text/html}
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	577 }
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	578 </citation>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	579 </citations>
01d94df2e32a planemo upload for repository https://bitbucket.org/lance_parsons/cutadapt_galaxy_wrapper lparsons parents: 9 diff changeset	580
0 8b064ea16722 Initial version with multiple adapter support Lance Parsons <lparsons@princeton.edu> parents: diff changeset	581 </tool>

Mercurial > repos > lparsons > cutadapt

annotate cutadapt.xml @ 12:78e1cf88d133 draft