changeset 0:7dd1f41aee4d draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 1d1d9aac8cb96d043be07f2e4059baa3b05c2afc
author rnateam
date Wed, 28 Dec 2016 18:52:45 -0500
parents
children 9942e1b7646c
files locarna.tar.bz2 locarna_reliability_profile.xml macros.xml test-data/archaea-default.stdout test-data/archaea-probabilistic.aln test-data/archaea.fa test-data/archaea.tar.gz test-data/archaea_relplot.scr test-data/haca.snoRNA-default.stdout test-data/haca.snoRNA.fa test-data/haca.snoRNA_anchor.bed test-data/tRNA_2-1.fa test-data/tRNA_2-2.fa test-data/tRNA_2.aln test-data/tRNA_5.fa
diffstat 15 files changed, 637 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
Binary file locarna.tar.bz2 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/locarna_reliability_profile.xml	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,196 @@
+<tool id="locarna_reliability_profile" name="LocARNA reliability-profile" version="@VERSION@.0">
+    <description>
+        Plot reliability profile for probabilistic mlocarna
+    </description>
+
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    
+    <expand macro="requirements" />
+
+    <expand macro="stdio" />
+    
+    <expand macro="version" />
+    
+    <command><![CDATA[
+    (if file '$input_archive' | grep 'gzip compressed' > /dev/null ;
+    then tar xzf '$input_archive' ;
+    else tar xf '$input_archive' ;
+    fi)
+    &&
+    reliability-profile.pl mlocarna_results
+
+    --output-format='$output_format'
+
+    #if $output_format == 'pdf'
+         --out '$pdf_output_plot'
+    #else if $output_format == 'png'
+         --out '$png_output_plot'
+    #end if
+
+    #if str($title) != ""
+        --title '$title'
+    #end if
+
+    #if str($seqname) != ""
+        --seqname $seqname
+    #end if
+
+    --beta $beta
+    --structure-weight $structure_weight
+    
+    #if str($signals)!=""
+        --signals '$signals'
+    #end if
+
+    --offset $offset
+
+    #if $write_rscript:
+        --write-R-script '$rscript_output'
+    #end if
+
+    #if $write_subsequence
+        --write-subseq
+    #end if
+    
+    $predict
+    $fit_once_on
+    $show_sw
+    $rev_compl
+
+    > '$stdout'
+    ]]></command>
+    
+    <inputs>
+        <param name="input_archive" type="data" format="tar.gz" label="MLocARNA archive"
+               help="Archive of MLocARNA results (tar or tar.gz as generated by running
+                     mlocarna in probabilistic alignment mode)." />
+
+        <param name="title" type="text" label="Plot title"
+               help="Title of the plot"
+               />
+
+        <param name="seqname" type="text" label="Reference sequence"
+               help="Project to a reference sequence. Provide one of the sequence names in the alignment input
+                     or leave blank to plot without projection."
+               />
+
+        <param name="predict" type="boolean" checked="True"
+               truevalue="" falsevalue="--dont-predict"
+               argument="dont-predict"
+               help="Turn on/off predicting."
+               />
+
+        <param name="fit_once_on" type="boolean" checked="False"
+               truevalue="--fit-once-on" falsevalue=""
+               argument="fit-once-on"
+               help="Predict exactly one 'on'-region"
+               />
+
+        <param name="show_sw" type="boolean" checked="True"
+               truevalue="--show-sw" falsevalue=""
+               argument="show-sw"
+               help="Show the influence of structure weight."
+               />
+
+        <param name="rev_compl" type="boolean" checked="False"
+               truevalue="--revcompl" falsevalue=""
+               argument="revcompl"
+               help="Plot and fit a reverse complement."
+               />
+
+        <param argument="beta" help="Inverse temperature for fitting." 
+               type="float" value="12.0" min="1.0" max="25.0" />
+        
+        <param name="structure_weight" argument="structure-weight"
+               type="float" value="1.0" min="0.0" max="8.0"
+               help="Weight of structure against sequence (1.0 means equal)"
+               />
+ 
+        <param argument="offset" help="Genomic offset." 
+               type="integer" value="1" />
+        
+        <param name="signals" type="text" label="List of signals"
+               help="List of '{from to} orientation' signal specifications. Show signals in plot
+                     and compared infered signal to them. Ranges 'from to' can be repeated; 
+                     the orientation must be either +1 or -1.
+                     The specifications of the single signals are separated by ';'. Example of two signal, 
+                     where the first one consists of two ranges: 1 15 20 30 +1; 15 45 -1"
+               >
+            <sanitizer invalid_char=" ">
+                <valid initial="string.digits"> <add value="+" /> <add value="-" /> <add value=";" /> </valid>
+            </sanitizer>
+        </param>
+       
+        <param name="output_format" type="select" 
+               label="Output options">
+            <option value="pdf" selected="True">Plot in pdf
+            format</option>
+            <option value="png" selected="False">Plot in png format</option>
+        </param>
+
+        <param name="write_rscript" type="boolean" argument="write-R-script"
+               label="Write R script" checked="False"
+               help="Write R script that can produce the output plot."
+               />
+
+        <param name="write_subsequence" type="boolean" argument="write-subseq"
+               label="Write Subsequence" checked="False"
+               help="Write subsequence in output."
+               />
+        
+    </inputs>
+               
+    
+    <outputs>
+        <data format="pdf" name="pdf_output_plot"
+              label="${tool.name} reliability plot (pdf) ${on_string}">
+            <filter>output_format == 'pdf'</filter>
+        </data>
+        <data format="png" name="png_output_plot"
+              label="${tool.name} reliability plot (png) ${on_string}">
+            <filter>output_format == 'png'</filter>
+        </data>
+        <data format="txt" name="rscript_output"
+              label="${tool.name} reliability plot (R script) ${on_string}">
+            <filter> write_rscript is True </filter>
+        </data>
+        <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}" />
+    </outputs>
+    
+    <tests>
+        <test>
+            <param name="input_archive" value="archaea.tar.gz" />
+            <param name="write_rscript" value="True" />
+            <output name="rscript_output" file="archaea_relplot.scr" lines_diff="2" />
+        </test>
+    </tests>
+
+    <help><![CDATA[**Reliability Profiles for Multiple RNA
+Alignment**
+    
+This tool draws reliability profiles for mlocarna alignments that have
+been computed in probabilistic alignment mode. Moreover, it predicts
+reliably aligned regions, which can be used to determine the
+boundaries of well conserved structured RNA motifs in less closely
+related sequence context.
+    
+**Input.**
+Results archive of an alignment by the mlocarna tool; for this
+purpose, mlocarna must be run in probabilistic mode in order to
+generate the required reliability information.
+
+**Output.**
+Plot of the reliability profile for the input alignment. Moreover,
+a signal prediction is performed and predicted regions are
+annotated in the plot.
+
+
+For more information, see
+.. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/
+    ]]></help>
+
+    <expand macro="citations" />
+    
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,178 @@
+<macros>
+    <token name="@VERSION@">1.9.0</token>
+
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@VERSION@">locarna</requirement>
+        </requirements>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+        </stdio>
+    </xml>
+
+    <xml name="version">
+        <version_command>
+            <![CDATA[
+                     mlocarna --version
+            ]]>
+        </version_command>
+    </xml>
+
+    <xml name="bed_anchors">
+        <conditional name="bed_anchors">
+            <param name="bed_anchors_selector" type="select" label="Anchor constraints"
+                   help="Anchor constraints in bed format specify positions of
+                             named anchor regions per sequence. The sequence names
+                             ('contig' names have to correspond to the fasta input
+                             sequence names. Anchor names must be unique per sequence
+                             and regions of the same name for different sequences
+                             must have the same length. This constrains the alignment
+                             to align all regions of the same name.">
+                <option value="no">Don't load anchor constraints from bed file</option> 
+                <option value="yes">Load anchor constraints from bed file</option> 
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <param name="bed_anchors_file" type="data" format="tabular" 
+                       label="Anchor constraint specification in bed format"
+                       />
+            </when>
+        </conditional>
+    </xml>
+    
+    <xml name="common_scoring_parameters">
+        <param name="struct_weight" argument="struct-weight"
+               label="Structure weight" type="integer" 
+               value="200" min="0" max="800" />
+        <param name="indel_opening" argument="indel-opening"
+               label="Indel opening score" type="integer"
+               value="-500" max="0" min="-1500" />
+        <param argument="indel" label="Indel score" type="integer" 
+               value="-350" min="-1000" max="0" />
+        <param argument="tau" type="integer" value="50"
+               min="0" max="200"
+               label="Sequence contribution at structure match in percent"/> 
+
+        <conditional name="sequence_score">
+            <param name="sequence_score_selector" type="select" label="Type of sequence score contribution">
+                <option value="ribofit">Use ribofit</option>
+                <option value="ribosum">Use RIBOSUM85_60</option>
+                <option value="match">Simple match/mismatch costs</option>
+            </param>
+            <when value="ribofit" />
+            <when value="ribosum" />
+            <when value="match">
+                <param name="match" type="integer" value="50" 
+                       min="0" max="400"
+                       label="Match score" />
+                <param name="mismatch" type="integer" value="0" 
+                       min="-400" max="0"
+                       label="Mismatch score" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="plfolding_parameters">
+        <param name="plfold_span" argument="--plfold-span" 
+               type="integer" value="150" min="-1" max="400" 
+               label="Maximum basepair span by RNAplfold (local folding); -1 for global folding" />
+        
+        <param name="plfold_winsize" argument="--plfold-winsize"
+               type="integer" value="300"  min="-1" max="800" 
+               label="Window size for local folding" />
+    </xml>
+    
+    <xml name="common_folding_parameters">
+        <param name="rnafold_temperature" argument="rnafold-temperature"
+               type="float" value="37.0" min="10" max="50"
+               label="Temperature for RNAfold (RNAfold's -T option)" />
+    </xml>
+
+    <xml name="common_heuristic_parameters">
+        <param  name="min_prob" argument="min-prob" type="float" value="0.0005" 
+                min="0.0" max="0.2"
+                label="Minimal / cutoff probability" /> 
+
+        <param  name="max_diff_am" argument="max-diff-am" 
+                type="integer" value="30" 
+                min="-1" max="300"
+                label="Maximal difference for sizes of matched arcs (-1=off)" /> 
+
+        <param  name="max_diff" argument="max-diff" type="integer"
+                value="60" min="-1" max="300"
+                label="Maximal difference for alignment traces (-1=off)" /> 
+
+        <param  name="max_diff_at_am" argument="max-diff-am" type="integer" 
+                value="-1" min="-1" max="300"
+                label="Maximal difference for alignment traces, only at arc match positions" /> 
+        
+        <param  name="max_bps_length_ratio" argument="max-bps-length-ratio"
+                type="float" value="0.0" min="0.0" max="1.0" 
+                label="Maximal ratio of #base pairs divided by sequence length (default: no effect)" /> 
+    </xml>
+
+    <xml name="alifold_consensus_parameter">
+        <param  name="alifold_consensus_dp" argument="alifold-consensus-dp" 
+                type="boolean" checked="false" 
+                truevalue="--alifold-consensus-dp" falsevalue=""
+                label="Compute consensus dot plot by alifold" />
+    </xml>
+    
+    <xml name="constraints">
+        <param name="lonely_pairs" type="boolean" truevalue="--LP" falsevalue="--noLP" 
+               checked="false" label="Allow lonely base-pairs" help="(--LP/--noLP)" />
+        <param name="maxBPspan" argument="--maxBPspan" 
+               type="integer" value="-1" min="-1" max="400" 
+               label="Maximum basepair span by RNAfold; -1 for arbitrary span" />
+        <param name="ignore_constraints" argument="ignore-constraints"
+               type="boolean" checked="false" truevalue="--ignore-constraints" falsevalue=""
+               help="Ignore all anchor and structure constraints given
+                     in the fasta(-ish) input." />
+    </xml>
+
+    <xml name="common_other_parameters">
+    </xml>
+
+    <xml name="common_outputs">
+        <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}">
+            <filter>stdout_verbosity != '--quiet'</filter>
+        </data>
+        <data format="clustal" name="clustal" from_work_dir="mlocarna_results/results/result.aln"
+              label="${tool.name} alignment (annotated clustal) on ${on_string}">
+            <filter>'clustal' in outputs</filter>
+        </data>
+        <data format="clustal" name="clustal_strict" 
+              from_work_dir="mlocarna_results/results/result.strict-aln"
+              label="${tool.name} alignment (clustal) on ${on_string}">
+            <filter>'clustal_strict' in outputs</filter>
+        </data>
+        <data format="stockholm" name="stockholm" from_work_dir="mlocarna_results/results/result.stk"
+              label="${tool.name} alignment (stockholm) on ${on_string}">
+            <filter>'stockholm' in outputs</filter>
+        </data>
+        <data format="txt" name="pp"
+              from_work_dir="mlocarna_results/results/result.pp"
+              label="${tool.name} alignment (PP 2.0) on ${on_string}">
+            <filter>'pp' in outputs</filter>
+        </data>
+        <data format="tar.gz" name="mlocarna_results_tgz"
+              label="${tool.name} results archive on ${on_string}">
+            <filter>'mlocarna_results' in outputs</filter>
+        </data>
+    </xml>
+
+    <xml name="citations">
+        <citations>
+            <citation
+            type="doi">10.1371/journal.pcbi.0030065</citation>
+            <citation type="doi">10.1261/rna.029041.111</citation>
+        </citations>
+    </xml>
+
+
+
+</macros>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea-default.stdout	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,18 @@
+mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0
+Copyright Sebastian Will
+
+Compute pair probs ...
+Compute pairwise alignments ... 
+Perform progressive alignment ...
+
+
+
+vhuU               AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU-
+fwdB               AU-GUUGGAGGGGAACCC-GU------------AAGGGACCCUCCAAGAU-
+selD               UUACGAUGUGCCGAACCCUUU------------AAGGGAGGCACAUCGAAA
+hdrA               GG--CACCACUCGAAGGC--U------------AAGCCAAAGUGGUG-CU-
+vhuD               GU--UCUCUCGGGAACCCGUC------------AAGGGACCGAGAGA-AC-
+fruA               ---CCUCGAGGGGAACCC-GA------------AAGGGACCCGAGAGG---
+fdhA               CG-CCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGGCG-
+
+alifold            ((.(((((((((...(((.................))).))))))))))). (-31.59 = -20.01 + -11.58)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea-probabilistic.aln	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,11 @@
+CLUSTAL W --- LocARNA 1.9.0
+
+
+
+selD               UUACGAUGUGCCGAACCCUU------------UAAGGGAGGCACAUCGAAA
+vhuU               AGC-UCACAACCGAACCCAU-------------UUGGGAGGUUGUGAG-CU
+fwdB               AUG-UUGGAGGGGAACCCGU-------------AAGGGACCCUCCAAG-AU
+hdrA               GGC-ACC-ACUCGAAGGCU--------------AAGCCAAAGU-GGUG-CU
+vhuD               GUU-CUC-UCGGGAACCCGU------------CAAGGGACCGA-GAGA-AC
+fdhA               CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGG-CG
+fruA               CC-UCG--AGGGGAACCCGA-------------AAGGGACCC--GAGA-GG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea.fa	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,14 @@
+>fruA
+CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG
+>fdhA
+CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG
+>vhuU
+AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU
+>hdrA
+GGCACCACUCGAAGGCUAAGCCAAAGUGGUGCU
+>vhuD
+GUUCUCUCGGGAACCCGUCAAGGGACCGAGAGAAC
+>selD
+UUACGAUGUGCCGAACCCUUUAAGGGAGGCACAUCGAAA
+>fwdB
+AUGUUGGAGGGGAACCCGUAAGGGACCCUCCAAGAU
Binary file test-data/archaea.tar.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea_relplot.scr	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,137 @@
+pdf("/tmp/tmp5yxSuG/files/000/dataset_2.dat",width=12,height=4,version="1.4")
+
+rel    <- read.table("mlocarna_results/results/result.bmreliability");
+seqrel <- rel[[2]]
+strrel <- rel[[3]]
+
+if ("" != "") {
+  seq <- ""
+  seq <- strsplit(seq,split="")
+  tab <- unlist(seq)!="-"
+
+  seqrel<-seqrel[tab]
+  strrel<-strrel[tab]
+}
+
+len<-length(seqrel)
+
+if (0) {
+  seqrel<-seqrel[len:1]
+  strrel<-strrel[len:1]
+}
+
+
+
+if (1) {
+  seqrel <- seqrel/1.0
+}
+
+
+totalrel <- seqrel+strrel;
+
+anno_space<-0.075
+
+maxy <- max(c(1,totalrel))+anno_space*(0+1);
+
+
+firstpos <- 1
+lastpos  <- 1+len-1
+
+if (0) {
+  the_xlim <- c(lastpos,firstpos)
+} else {
+  the_xlim <- c(firstpos,lastpos)
+}
+
+# set margin
+# b, l, t, r
+par(mar=c(6,2.5,1,1))
+
+# open plot (and draw threshold)
+plot(c(0),c(0),type="l",                                        
+     xlab="",ylab="",
+     xlim=the_xlim,ylim=c(0,maxy),
+     yaxp=c(0,1,2))
+
+## title inside of plot
+legend("topleft","",bty="n")
+
+
+# total reliability
+polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,totalrel,0),col=rgb(0.8,0.8,0.9,0.5),lwd=2,border=FALSE)
+lines(firstpos:lastpos,totalrel,col="blue",lwd=2)
+
+# plot structure reliability
+polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,strrel,0),col=rgb(0.3,0.3,0.5,0.8),lwd=1,border=FALSE)
+
+
+## draw other signals
+signals<-c();
+signal_sizes<-c();
+
+signal_starts <- 1:0
+
+signal_starts[1]<-1;
+if (0>1) {
+  for (i in 2:0) {
+    signal_starts[i]<-signal_starts[i-1]+signal_sizes[i-1]*2+1;
+  }
+}
+
+colors <- c(
+    rgb(0.6,0.1,0.1,0.9),
+    rgb(0.6,0.6,0.1,0.9),
+    rgb(0.1,0.6,0.6,0.9),
+    rgb(0.6,0.1,0.6,0.9)
+);
+colors<-c(colors,colors);
+
+if (0>0) {
+  
+  for (i in 1:0) {
+    orientation <- signals[signal_starts[i]+signal_sizes[i]*2];
+    sig_y  <- maxy-i*anno_space;
+    
+    for (j in 0:(signal_sizes[i]-1)) {
+
+      sig_x <- c(signals[signal_starts[i]+j*2],signals[signal_starts[i]+j*2+1]);
+          
+      ## draw arrows
+      if (orientation!=0) {
+        the_code <- 1+(orientation+1)/2;
+        arrows(sig_x[1],sig_y,sig_x[2],sig_y,lwd=4,col=colors[i],code=the_code,angle=20,length=0.15);
+      } else {
+        lines(sig_x,c(sig_y,sig_y),lwd=4,col=colors[i]);
+      }
+    }
+  }
+}
+
+#draw inferred on-signal
+hit_color <- rgb(0.1,0.6,0.1,0.9)
+  
+if (0!=1) {
+  
+  on  <- c(0,4,33,44,49);
+  off <- c(3,20,43,48,51);
+
+  if (length(on)>0) {
+    for (i in 1:length(on)) {
+      lines(c(1+on[i],1+off[i]-1),c(maxy,maxy),lwd=7,col=hit_color);
+    }
+  }
+
+  ### draw on/off values
+  if (0) {
+    lines(c(1,1+len),c(0.0355791,0.0355791),lty=2,lwd=1)
+    lines(c(1,1+len),c(0.702675,0.702675),lty=2,lwd=1)
+  }
+}
+
+
+signal_names<-c();
+
+if (length(signal_names)>0 || (0!=1)) {
+  legend("bottom",c("LocARNA",signal_names),lwd=7,col=c(hit_color,colors),horiz=TRUE,inset=-0.4);
+  # ,xpd=TRUE
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA-default.stdout	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,33 @@
+mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0
+Copyright Sebastian Will
+
+Compute pair probs ...
+Compute pairwise alignments ... 
+Perform progressive alignment ...
+
+
+
+ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUUCGGAA-AGGG
+ACA30              UGGCACUUUCACAG--UUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGU
+ACA5               UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAA--GGC
+ACA59              GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG-CCCAUGGGUGAC--CCU
+#A1                ............................................................
+#A2                ............................................................
+
+ACA7               AGGGAAAGCAAGCCUGGCAGAG-GCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCG
+ACA30              GCUGAGAGAAAAC---CC-UUG---AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGG
+ACA5               UGCCACAGAAACAC--UGUGAC-UCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAG
+ACA59              GGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA
+#A1                ....AAAAAA..................................................
+#A2                ....123456..................................................
+
+ACA7               AUUGGA--AGA---CACU-CUGCG-----ACA
+ACA30              CAACUG--UCA---CUCA-AUGGG-----ACA
+ACA5               GGAUAA--AUU---UGGU-UACAG-----ACA
+ACA59              ACAAUACUUACUCUCGUUGGUGAUAAGGAACA
+#A1                .............................BBB
+#A2                .............................123
+
+alifold            .((((((((........((((.(((((((......))))))).))))......))..)))
+                   ))).............((((((.....((.....((((((((((((.....)))))))))
+                   )))......)).....)).))))......... (-61.69 = -33.85 + -27.84)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA.fa	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,21 @@
+>ACA59
+GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGGCCCAUGGGUGACCCUGGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACA
+.............................................................xxxxxx...............................................................................xxx #S
+.............................................................AAAAAA...............................................................................BBB #1
+.............................................................123456...............................................................................123 #2
+
+>ACA7
+ACCUCCUGGGAUCGCAUCUGGAGAGUGCCUAGUAUUCUGCCAGCUUCGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCGAUUGGAAGACACUCUGCGACA
+...........................................................xxxxxx...................................................................xxx #S
+...........................................................AAAAAA...................................................................BBB #1
+...........................................................123456...................................................................123 #2
+>ACA5
+UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAAGGCUGCCACAGAAACACUGUGACUCAUGGGCCCUGUUCCUGUGUCCCAGGCUCAGGGAUAAAUUUGGUUACAGACA
+..............................................................xxxxxx............................................................xxx #S
+..............................................................AAAAAA............................................................BBB #1
+..............................................................123456............................................................123 #2
+>ACA30
+UGGCACUUUCACAGUUCCUUCCCCAGGCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAACCCUUGAUUGUAUUCUUGCCCUGGGAUUAUACCAGUGGCAACUGUCACUCAAUGGGACA
+..........................................................xxxxxx..........................................................xxx #S
+..........................................................AAAAAA..........................................................BBB #1
+..........................................................123456..........................................................123 #2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA_anchor.bed	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,8 @@
+ACA59	61	67	ANANNA
+ACA7	59	65	ANANNA
+ACA5	62	68	ANANNA
+ACA30	58	64	ANANNA
+ACA59	146	149	ACA
+ACA7	132	135	ACA
+ACA5	128	131	ACA
+ACA30	122	125	ACA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2-1.fa	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,2 @@
+>D10744
+GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2-2.fa	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,2 @@
+>AF008220
+GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2.aln	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,7 @@
+CLUSTAL W --- LocARNA 1.9.0 --- Score: 2875
+
+D10744             GGAAAAUU-GAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGG
+AF008220           GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGG-----------UCG
+
+D10744             UGAGUUCGAAUCUCACAUUUUCCG
+AF008220           GCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_5.fa	Wed Dec 28 18:52:45 2016 -0500
@@ -0,0 +1,10 @@
+>D10744
+GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG
+>AF008220
+GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA
+>Z11880
+GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG
+>X02172
+GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA
+>M68929
+GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC