Mercurial > repos > rnateam > locarna_reliability_profile

changeset 1:9942e1b7646c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 287021573c592fdb70fdbbc88943aa16a8740fc0
author rnateam
date Fri, 13 Jan 2017 16:49:01 -0500
parents 7dd1f41aee4d
children dd991ca3d8ce
files locarna_reliability_profile.xml macros.xml test-data/archaea-ref.aln test-data/archaea-ref_result.aln test-data/ferritin_human.fa test-data/ferritin_mouse.fa test-data/haca.snoRNA-1.aln test-data/haca.snoRNA-2.aln test-data/haca.snoRNA-c.aln test-data/haca.snoRNA.aln test-data/tRNA_2.amprobs test-data/tRNA_2.bmprobs test-data/tRNA_2.epms
diffstat 13 files changed, 526 insertions(+), 28 deletions(-) [+]
line wrap: on
line diff
--- a/locarna_reliability_profile.xml	Wed Dec 28 18:52:45 2016 -0500
+++ b/locarna_reliability_profile.xml	Fri Jan 13 16:49:01 2017 -0500
@@ -1,4 +1,4 @@
-<tool id="locarna_reliability_profile" name="LocARNA reliability-profile" version="@VERSION@.0">
+<tool id="locarna_reliability_profile" name="LocARNA reliability-profile" version="@VERSION@.1">
     <description>
         Plot reliability profile for probabilistic mlocarna
     </description>
@@ -34,7 +34,7 @@
     #end if
 
     #if str($seqname) != ""
-        --seqname $seqname
+        --seqname '$seqname'
     #end if
 
     --beta $beta
--- a/macros.xml	Wed Dec 28 18:52:45 2016 -0500
+++ b/macros.xml	Fri Jan 13 16:49:01 2017 -0500
@@ -25,14 +25,16 @@
         <conditional name="bed_anchors">
             <param name="bed_anchors_selector" type="select" label="Anchor constraints"
                    help="Anchor constraints in bed format specify positions of
-                             named anchor regions per sequence. The sequence names
-                             ('contig' names have to correspond to the fasta input
-                             sequence names. Anchor names must be unique per sequence
-                             and regions of the same name for different sequences
-                             must have the same length. This constrains the alignment
-                             to align all regions of the same name.">
-                <option value="no">Don't load anchor constraints from bed file</option> 
-                <option value="yes">Load anchor constraints from bed file</option> 
+                         named anchor regions per sequence. The sequence names
+                         ('contig' names have to correspond to the fasta input
+                         sequence names. Anchor names must be unique per sequence
+                         and regions of the same name for different sequences
+                         must have the same length. This constrains the alignment
+                         to align all regions of the same name.">
+                <option value="no">Don't load anchor constraints from
+                bed file</option>
+                <option value="yes">Load anchor constraints from bed
+                file</option>
             </param>
             <when value="no" />
             <when value="yes">
@@ -91,37 +93,176 @@
                label="Temperature for RNAfold (RNAfold's -T option)" />
     </xml>
 
+    <token name="@SCORING_ARGS@">
+        ## -------------------- scoring parameters
+        --indel $Scoring.indel
+        --indel-opening $Scoring.indel_opening
+        --struct-weight $Scoring.struct_weight
+        --tau $Scoring.tau
+        
+        #if str($Scoring.sequence_score.sequence_score_selector) == "match"
+            --match $Scoring.sequence_score.match
+            --mismatch $Scoring.sequence_score.mismatch
+        #elif str($Scoring.sequence_score.sequence_score_selector) == "ribosum"
+            --use-ribosum true
+        #elif str($Scoring.sequence_score.sequence_score_selector) == "ribofit"
+            --ribofit true
+        #end if
+    </token>
+
+    <token name="@FOLDING_ARGS@">
+        ## -------------------- folding parameters
+        #if float($Folding.rnafold_temperature) != 37.0
+            --rnafold-temperature $Folding.rnafold_temperature
+        #end if
+    </token>
+
+    <token name="@HEURISTIC_ARGS@">
+        ## -------------------- heuristic parameters
+        -p $Heuristics.min_prob
+
+        #if str($Heuristics.max_diff_mode.max_diff_mode_selector) == "off"
+            --max-diff -1
+        #elif str($Heuristics.max_diff_mode.max_diff_mode_selector) == "max-diff"
+            --max-diff $Heuristics.max_diff_mode.max_diff
+        #elif str($Heuristics.max_diff_mode.max_diff_mode_selector) == "max-diff-at-am"
+            --max-diff -1
+            --max-diff-at-am $Heuristics.max_diff_mode.max_diff_at_am
+        #elif str($Heuristics.max_diff_mode.max_diff_mode_selector) == "max-diff-aln"
+            --max-diff $Heuristics.max_diff_mode.max_diff
+            --max-diff-aln '$Heuristics.max_diff_mode.max_diff_aln'
+            $Heuristics.max_diff_mode.max_diff_relax
+        #end if
+        
+        --max-diff-am $Heuristics.max_diff_am
+    
+        #if float($Heuristics.max_bps_length_ratio) > 0.0
+            --max-bps-length-ratio $Heuristics.max_bps_length_ratio
+        #end if
+    </token>
+
+    <token name="@CONSTRAINT_ARGS@">
+        ## -------------------- constraint parameters
+        $Constraints.lonely_pairs
+
+        #if $Constraints.maxBPspan != -1
+            --maxBPspan $Constraints.maxBPspan
+        #end if
+
+        $Constraints.ignore_constraints
+    </token>
+
+    <token name="@STDOUT_ARGS@">
+        $stdout_verbosity
+        
+        #if str($stdout_verbosity) != "--quiet":
+            > '$stdout'
+        #end if
+    </token>
+
+    <xml name="max_diff_parameters_selector">
+        <param name="max_diff_mode_selector" type="select"
+               label="Restrict alignable positions by maximum difference" 
+               help="(max-diff*)">
+            <option value="off">Off</option>
+            <option value="max-diff" selected="True">Maximal difference of aligned positions</option>
+            <option value="max-diff-at-am">Maximal difference of aligned positions at arc matches</option> 
+            <yield />
+        </param>
+    </xml>
+    
+    <xml name="max_diff_parameters_standard_cases">
+        <when value="off" />
+        <when value="max-diff">
+            <param  name="max_diff" argument="max-diff" type="integer"
+                    value="60" min="-1" max="300"
+                    label="Maximal difference of aligned positions" />
+        </when>
+        <when value="max-diff-at-am">
+            <param  name="max_diff_at_am" argument="max-diff-at-am" type="integer" 
+                    value="60" min="-1" max="300"
+                    label="Maximal difference of aligned positions,
+                           only at arc match positions" />
+        </when>
+    </xml>
+
+    <xml name="max_diff_parameters">
+        <conditional name="max_diff_mode">
+            <expand macro="max_diff_parameters_selector" />
+            <expand macro="max_diff_parameters_standard_cases" />
+        </conditional>
+    </xml>
+
+    <xml name="max_diff_parameters_aln">
+        <conditional name="max_diff_mode">
+            <expand macro="max_diff_parameters_selector">
+                <option value="max-diff-aln">Maximal difference to a reference alignment</option>
+            </expand>
+            <expand macro="max_diff_parameters_standard_cases" />
+            <when value="max-diff-aln">
+                <param name="max_diff_aln" argument="max-diff-aln" type="data" format="clustal"
+                       label="Reference alignment"
+                       />
+                <param  name="max_diff" argument="max-diff" type="integer"
+                        value="60" min="-1" max="300"
+                        label="Maximal difference of aligned positions" />
+                <param name="max_diff_relax" argument="max-diff-relax" type="boolean"
+                       truevalue="--max-diff-relax" falsevalue=""
+                       checked="False"
+                       label="Relax deviation constraints in multiple
+                              aligmnent."
+                       />
+            </when>
+        </conditional>
+    </xml>
+
     <xml name="common_heuristic_parameters">
         <param  name="min_prob" argument="min-prob" type="float" value="0.0005" 
                 min="0.0" max="0.2"
                 label="Minimal / cutoff probability" /> 
-
+    
         <param  name="max_diff_am" argument="max-diff-am" 
                 type="integer" value="30" 
                 min="-1" max="300"
-                label="Maximal difference for sizes of matched arcs (-1=off)" /> 
-
-        <param  name="max_diff" argument="max-diff" type="integer"
-                value="60" min="-1" max="300"
-                label="Maximal difference for alignment traces (-1=off)" /> 
-
-        <param  name="max_diff_at_am" argument="max-diff-am" type="integer" 
-                value="-1" min="-1" max="300"
-                label="Maximal difference for alignment traces, only at arc match positions" /> 
+                label="Maximal difference for sizes of matched arcs (-1=off)" />
         
         <param  name="max_bps_length_ratio" argument="max-bps-length-ratio"
-                type="float" value="0.0" min="0.0" max="1.0" 
-                label="Maximal ratio of #base pairs divided by sequence length (default: no effect)" /> 
+                type="float" value="0.0" min="0.0" max="10.0" 
+                label="Maximal ratio 'number of considered base pairs' by
+                       'sequence length' (default: 0.0 = no effect)" />
+    </xml>
+    
+    <xml name="in_loop_ratio_parameters">
+        <param  name="max_uil_length_ratio" argument="max-uil-length-ratio"
+                type="float" value="0.0" min="0.0" max="10.0" 
+                label="Maximal ratio 'number considered unpaired bases in loops' by
+                       'sequence length' (default: 0.0; no effect)" />
+        
+        <param  name="max_bpil_length_ratio" argument="max-bpil-length-ratio"
+                type="float" value="0.0" min="0.0" max="10.0" 
+                label="Maximal ratio 'number of considered base pairs in loops'
+                       by 'sequence length' (default: 0.0; no effect)" />
+    </xml>
+
+    <xml name="exparnap_in_loop_parameters">
+        <param  name="prob_unpaired_in_loop_threshold"
+                argument="prob_unpaired_in_loop_threshold"
+                type="float" value="0.01" min="0.0" max="1.0" 
+                label="Probability threshold for unpaired bases in loops" />
+        <param  name="prob_basepair_in_loop_threshold"
+                argument="prob_basepair_in_loop_threshold"
+                type="float" value="0.01" min="0.0" max="1.0" 
+                label="Probability threshold for base pairs in loops" />
     </xml>
 
     <xml name="alifold_consensus_parameter">
         <param  name="alifold_consensus_dp" argument="alifold-consensus-dp" 
-                type="boolean" checked="false" 
+                type="boolean" checked="False" 
                 truevalue="--alifold-consensus-dp" falsevalue=""
                 label="Compute consensus dot plot by alifold" />
     </xml>
     
-    <xml name="constraints">
+    <xml name="common_constraint_parameters">
         <param name="lonely_pairs" type="boolean" truevalue="--LP" falsevalue="--noLP" 
                checked="false" label="Allow lonely base-pairs" help="(--LP/--noLP)" />
         <param name="maxBPspan" argument="--maxBPspan" 
@@ -133,13 +274,14 @@
                      in the fasta(-ish) input." />
     </xml>
 
-    <xml name="common_other_parameters">
-    </xml>
-
-    <xml name="common_outputs">
+    <xml name="standard_outupt">
         <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}">
             <filter>stdout_verbosity != '--quiet'</filter>
         </data>
+    </xml>
+
+    <xml name="mlocarna_outputs">
+        <expand macro="standard_outupt" />
         <data format="clustal" name="clustal" from_work_dir="mlocarna_results/results/result.aln"
               label="${tool.name} alignment (annotated clustal) on ${on_string}">
             <filter>'clustal' in outputs</filter>
@@ -169,6 +311,8 @@
             <citation
             type="doi">10.1371/journal.pcbi.0030065</citation>
             <citation type="doi">10.1261/rna.029041.111</citation>
+            <citation type="doi">10.1093/bioinformatics/btv185</citation>
+            <citation type="doi">10.1186/s12859-014-0404-0</citation>
         </citations>
     </xml>
 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea-ref.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,9 @@
+CLUSTAL W --- LocARNA 1.9.0
+
+selD               UUACGAUGUGCCGAACCCUU------------UAAGGGAGGCACAUCGAAA
+vhuU               AGC-UCACAACCGAACCCAU-------------UUGGGAGGUUGUGAG-CU
+fwdB               AUG-UUGGAGGGGAACCCGU-------------AAGGGACCCUCCAAG-AU
+hdrA               GGC-ACC-ACUCGAAGGCU--------------AAGCCAAAGU-GGUG-CU
+vhuD               GUU-CUC-UCGGGAACCCGU------------CAAGGGACCGA-GAGA-AC
+fdhA               CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGG-CG
+fruA               CC-UCG--AGGGGAACCCGA-------------AAGGGACCC--GAGA-GG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/archaea-ref_result.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,11 @@
+CLUSTAL W --- LocARNA 1.9.0
+
+
+
+vhuU               AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU-
+fwdB               AU-GUUGGAGGGGAACCC-GU------------AAGGGACCCUCCAAGAU-
+selD               UUACGAUGUGCCGAACCCUUU------------AAGGGAGGCACAUCGAAA
+hdrA               GG--CACCACUCGAAGGC--U------------AAGCCAAAGUGGUG-CU-
+vhuD               GU--UCUCUCGGGAACCCGUC------------AAGGGACCGAGAGA-AC-
+fruA               ---CCUCGAGGGGAACCC-GA------------AAGGGACCCGAGAGG---
+fdhA               CG-CCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGGCG-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ferritin_human.fa	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,2 @@
+> human ferritin
+CCAGACGUUCUUCGCCGAGAGUCGUCGGGGUUUCCUGCUUCAACAGUGCUUGGACGGAACCCGGCGCUCGUUCCCCACCCCGGCCGGCCGCCCAUAGCCAGCCCUCCGUCACCUCUUCACCGCACCCUCGGACUGCCCCAAGGCCCCCGCCGCCGCUCCAGCGCCGCGCAGCCACCGCCGCCGCCGCCGCCUCUCCUUAGUCGCCGCC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ferritin_mouse.fa	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,2 @@
+> mouse ferritin
+CAGACGUUCUCGCCCAGAGUCGCCGCGGUUUCCUGCUUCAACAGUGCUUGAACGGAACCCGGUGCUCGACCCCUCCGACCCCCGCCGGCCGCUUCGAGCCUGAGCCCUUUGCAACUUCGUCGUUCCGCCGCUCCAGCGUCGCCACCGCGCCUCGCCCCGCCGCCACC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA-1.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,5 @@
+ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUU-CGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCGAUUGGAAGACACUCUGCGACA
+ACA30              UGGCACUUU--CACAGUUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAAC---CC-UUG--AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGGCAACUGUCACUCAAUGGGACA
+ACA5               UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGC--CCAGAAGGCUGCCACAGAAACAC--UGUGACUCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAGGGAUAAAUUUGGUUACAGACA
+#A1                ................................................................AAAAAA...................................................................BBB
+#A2                ................................................................123456...................................................................123
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA-2.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,3 @@
+ACA59 GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGGCCCAUGGGUGACCCUGGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACA
+#A1 .............................................................AAAAAA...............................................................................BBB
+#A2 .............................................................123456...............................................................................123
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA-c.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,22 @@
+CLUSTAL W --- LocARNA 1.9.0
+
+ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUU-CGGAAAGGG
+ACA30              UGGCACUUU--CACAGUUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGU
+ACA5               UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGC--CCAGAAGGC
+ACA59              GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG-CCCAUG--GGUGACCCU
+#A1                ............................................................
+#A2                ............................................................
+
+ACA7               AGGGAAAGCAAGCCUGGCAGAG-GCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCG
+ACA30              GCUGAGAGAAAAC---CC-UUG---AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGG
+ACA5               UGCCACAGAAACAC--UGUGAC-UCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAG
+ACA59              GGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA
+#A1                ....AAAAAA..................................................
+#A2                ....123456..................................................
+
+ACA7               AUUGGA--AGA---CACU-CUGCG-----ACA
+ACA30              CAACUG--UCA---CUCA-AUGGG-----ACA
+ACA5               GGAUAA--AUU---UGGU-UACAG-----ACA
+ACA59              ACAAUACUUACUCUCGUUGGUGAUAAGGAACA
+#A1                .............................BBB
+#A2                .............................123
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/haca.snoRNA.aln	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,16 @@
+CLUSTAL W --- LocARNA 1.9.0
+
+ACA7               ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUU-CGGAAAGGG
+ACA30              UGGCACUUU--CACAGUUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGU
+ACA5               UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGC--CCAGAAGGC
+ACA59              GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG-CCCAUG--GGUGACCCU
+
+ACA7               AGGGAAAGCAAGCCUGGCAGAG-GCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCG
+ACA30              GCUGAGAGAAAAC---CC-UUG---AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGG
+ACA5               UGCCACAGAAACAC--UGUGAC-UCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAG
+ACA59              GGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA
+
+ACA7               AUUGGA--AGA---CACU-CUGCG-----ACA
+ACA30              CAACUG--UCA---CUCA-AUGGG-----ACA
+ACA5               GGAUAA--AUU---UGGU-UACAG-----ACA
+ACA59              ACAAUACUUACUCUCGUUGGUGAUAAGGAACA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2.amprobs	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,108 @@
+64 69 54 59 0.079977
+63 70 53 60 0.0158884
+63 71 53 61 0.0915855
+62 72 52 62 0.203921
+61 73 51 63 0.202155
+60 74 50 64 0.175676
+59 75 49 65 0.0815626
+39 44 33 38 0.0114647
+39 46 33 37 0.0168669
+38 47 33 38 0.0303705
+37 48 32 39 0.0111801
+37 48 31 39 0.0434528
+36 42 34 38 0.0105213
+36 42 33 37 0.0442772
+36 42 33 38 0.0150469
+36 49 30 40 0.0445378
+35 40 33 37 0.0438048
+35 40 33 38 0.0131652
+35 43 33 37 0.0482007
+35 43 33 38 0.0524118
+35 43 32 39 0.0124841
+35 44 33 38 0.0456243
+35 44 32 39 0.0111628
+35 46 33 37 0.0220704
+35 50 29 41 0.016731
+34 44 33 38 0.0275446
+34 44 32 39 0.0318614
+34 44 31 39 0.0265932
+34 45 32 39 0.0344691
+33 42 31 39 0.123358
+33 47 31 39 0.0238501
+33 48 31 39 0.207448
+33 48 30 40 0.0278532
+33 49 32 39 0.0279853
+33 49 30 40 0.0365409
+32 36 33 37 0.0659838
+32 37 33 38 0.0229925
+32 40 31 39 0.01072
+32 43 30 40 0.102105
+32 45 31 39 0.0127413
+32 45 30 40 0.0472967
+32 46 30 40 0.0814206
+32 50 29 41 0.012395
+31 38 32 39 0.0108954
+31 44 29 41 0.0212986
+31 46 29 41 0.0101171
+31 50 30 40 0.105751
+31 50 29 41 0.490312
+31 50 28 42 0.0414615
+30 38 31 39 0.10883
+30 51 29 41 0.110433
+30 51 28 42 0.628654
+30 51 27 43 0.0377824
+29 39 30 40 0.119173
+29 52 28 42 0.130101
+29 52 27 43 0.657133
+28 40 29 41 0.103713
+28 53 27 43 0.113664
+28 53 25 45 0.0385623
+27 41 28 42 0.114432
+27 54 25 45 0.651098
+26 42 27 43 0.107977
+26 55 25 45 0.119566
+26 55 23 47 0.0239947
+26 56 25 46 0.011099
+26 56 24 47 0.147548
+26 56 23 47 0.0142523
+25 57 24 47 0.0172058
+25 57 22 48 0.0238997
+24 49 25 45 0.0155194
+24 57 23 47 0.0913467
+24 57 22 48 0.640114
+23 58 22 48 0.121828
+21 60 19 51 0.071982
+20 60 18 51 0.512044
+18 63 16 53 0.410891
+17 56 18 51 0.0172516
+17 64 15 54 0.505795
+17 65 15 55 0.0373483
+16 57 17 52 0.025034
+16 65 14 55 0.456198
+15 58 16 53 0.0181784
+15 67 13 57 0.463917
+14 19 13 18 0.0159303
+14 59 15 54 0.0239939
+14 68 12 58 0.536735
+13 60 14 55 0.0191717
+12 16 11 15 0.0116456
+12 21 13 22 0.0351601
+11 17 10 16 0.0359852
+11 22 12 23 0.0512024
+11 69 11 59 0.534042
+10 14 11 15 0.0213866
+10 23 11 24 0.0659783
+10 70 10 60 0.389747
+10 72 10 62 0.247777
+9 18 9 17 0.0444132
+9 73 8 63 0.0119982
+8 19 8 18 0.0421045
+8 74 9 64 0.0471423
+8 76 8 66 0.0271918
+7 76 7 66 0.821868
+6 77 6 67 0.869036
+5 78 5 68 0.962952
+4 79 4 69 0.963261
+3 80 3 70 0.872876
+2 81 2 71 0.752745
+1 82 1 72 0.752744
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2.bmprobs	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,172 @@
+1 1 0.247253
+2 2 0.247252
+3 3 0.127121
+4 4 0.0367335
+5 5 0.0369676
+6 6 0.129988
+7 7 0.156077
+8 8 0.835935
+8 9 0.012729
+9 8 0.010632
+9 9 0.727258
+9 10 0.0549287
+10 9 0.04195
+10 10 0.0853335
+10 11 0.0115868
+11 10 0.0364601
+11 11 0.112239
+12 10 0.011935
+12 11 0.0436248
+12 12 0.0614308
+13 11 0.0645154
+13 12 0.028434
+14 12 0.133445
+14 13 0.0169358
+15 13 0.260167
+15 14 0.0172799
+15 16 0.0124747
+16 14 0.271834
+16 15 0.0178714
+16 17 0.0141486
+17 15 0.185722
+17 16 0.0202801
+17 18 0.0184277
+18 16 0.300704
+18 17 0.0355582
+18 19 0.0165149
+19 17 0.700705
+19 18 0.0610097
+19 20 0.0138794
+20 18 0.193762
+20 19 0.11731
+20 21 0.012503
+21 19 0.633061
+21 20 0.119843
+22 20 0.625797
+22 21 0.127468
+23 20 0.0117929
+23 21 0.621337
+23 22 0.0118595
+23 24 0.0104834
+24 21 0.0184503
+24 22 0.0481581
+24 23 0.0441549
+24 25 0.0420745
+25 23 0.68405
+25 24 0.0269372
+25 26 0.0420693
+26 24 0.53624
+27 25 0.0346266
+27 26 0.120675
+28 26 0.681355
+28 27 0.0199945
+28 29 0.0196255
+29 27 0.0227404
+30 28 0.0396584
+30 29 0.0227396
+30 31 0.0165441
+31 29 0.121498
+31 32 0.114327
+32 30 0.351807
+32 31 0.0703916
+32 33 0.0332191
+33 31 0.0980398
+33 32 0.0266787
+33 34 0.0331979
+34 31 0.0122885
+34 32 0.400684
+34 33 0.0116529
+34 35 0.0331958
+35 32 0.0101403
+35 33 0.22599
+35 36 0.0332106
+36 33 0.0136772
+36 34 0.156117
+36 37 0.0332566
+37 34 0.0427905
+37 35 0.113127
+37 38 0.0933967
+38 35 0.0723242
+38 36 0.0618818
+39 34 0.0149807
+39 36 0.0997152
+39 37 0.0299675
+40 34 0.0108419
+40 35 0.01547
+40 37 0.111326
+40 38 0.0203761
+40 41 0.0196142
+41 35 0.0159003
+41 36 0.0127203
+41 38 0.149756
+42 34 0.0119499
+42 36 0.0189085
+42 37 0.010129
+42 39 0.0145996
+43 34 0.010789
+43 35 0.013731
+43 37 0.0170711
+43 38 0.0146016
+43 44 0.0354944
+44 35 0.0181452
+44 36 0.0122707
+44 38 0.0248855
+44 39 0.0183418
+44 45 0.0336616
+45 36 0.0423026
+45 39 0.0300877
+45 40 0.013096
+45 46 0.0286025
+46 37 0.0702926
+46 38 0.0130327
+46 40 0.0113529
+47 38 0.119444
+48 39 0.0264015
+48 40 0.0166626
+49 39 0.0133557
+49 40 0.309884
+50 41 0.109972
+51 41 0.0223073
+51 42 0.0365047
+52 43 0.0228365
+53 43 0.02009
+53 44 0.683193
+54 44 0.121387
+54 45 0.035521
+55 46 0.681952
+56 46 0.0343041
+56 47 0.536468
+56 48 0.0112514
+57 47 0.0531432
+57 48 0.0486503
+58 48 0.0521922
+58 49 0.632028
+59 49 0.117956
+59 50 0.628217
+60 50 0.0252284
+60 51 0.104879
+61 51 0.0460576
+61 52 0.573747
+62 52 0.165836
+62 53 0.0472354
+63 53 0.382375
+64 54 0.2672
+65 55 0.320519
+66 56 0.818192
+67 57 0.355528
+68 58 0.282881
+69 59 0.27801
+70 60 0.464549
+71 61 0.857675
+72 62 0.497193
+73 63 0.7313
+74 64 0.734773
+75 65 0.881053
+76 66 0.139472
+77 67 0.130956
+78 68 0.0370464
+79 69 0.0367371
+80 70 0.127122
+81 71 0.247251
+82 72 0.247251
+83 73 0.999955
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNA_2.epms	Fri Jan 13 16:49:01 2017 -0500
@@ -0,0 +1,4 @@
+epm_id	 score	 structure	 positions
+0	3583	((()))	1:4 2:5 3:6 80:67 81:68 82:69 
+1	3593	((()))	1:1 2:2 3:3 80:70 81:71 82:72 
+