Mercurial > repos > rnateam > locarna_reliability_profile
changeset 0:7dd1f41aee4d draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 1d1d9aac8cb96d043be07f2e4059baa3b05c2afc
| author | rnateam |
|---|---|
| date | Wed, 28 Dec 2016 18:52:45 -0500 |
| parents | |
| children | 9942e1b7646c |
| files | locarna.tar.bz2 locarna_reliability_profile.xml macros.xml test-data/archaea-default.stdout test-data/archaea-probabilistic.aln test-data/archaea.fa test-data/archaea.tar.gz test-data/archaea_relplot.scr test-data/haca.snoRNA-default.stdout test-data/haca.snoRNA.fa test-data/haca.snoRNA_anchor.bed test-data/tRNA_2-1.fa test-data/tRNA_2-2.fa test-data/tRNA_2.aln test-data/tRNA_5.fa |
| diffstat | 15 files changed, 637 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/locarna_reliability_profile.xml Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,196 @@ +<tool id="locarna_reliability_profile" name="LocARNA reliability-profile" version="@VERSION@.0"> + <description> + Plot reliability profile for probabilistic mlocarna + </description> + + <macros> + <import>macros.xml</import> + </macros> + + <expand macro="requirements" /> + + <expand macro="stdio" /> + + <expand macro="version" /> + + <command><![CDATA[ + (if file '$input_archive' | grep 'gzip compressed' > /dev/null ; + then tar xzf '$input_archive' ; + else tar xf '$input_archive' ; + fi) + && + reliability-profile.pl mlocarna_results + + --output-format='$output_format' + + #if $output_format == 'pdf' + --out '$pdf_output_plot' + #else if $output_format == 'png' + --out '$png_output_plot' + #end if + + #if str($title) != "" + --title '$title' + #end if + + #if str($seqname) != "" + --seqname $seqname + #end if + + --beta $beta + --structure-weight $structure_weight + + #if str($signals)!="" + --signals '$signals' + #end if + + --offset $offset + + #if $write_rscript: + --write-R-script '$rscript_output' + #end if + + #if $write_subsequence + --write-subseq + #end if + + $predict + $fit_once_on + $show_sw + $rev_compl + + > '$stdout' + ]]></command> + + <inputs> + <param name="input_archive" type="data" format="tar.gz" label="MLocARNA archive" + help="Archive of MLocARNA results (tar or tar.gz as generated by running + mlocarna in probabilistic alignment mode)." /> + + <param name="title" type="text" label="Plot title" + help="Title of the plot" + /> + + <param name="seqname" type="text" label="Reference sequence" + help="Project to a reference sequence. Provide one of the sequence names in the alignment input + or leave blank to plot without projection." + /> + + <param name="predict" type="boolean" checked="True" + truevalue="" falsevalue="--dont-predict" + argument="dont-predict" + help="Turn on/off predicting." + /> + + <param name="fit_once_on" type="boolean" checked="False" + truevalue="--fit-once-on" falsevalue="" + argument="fit-once-on" + help="Predict exactly one 'on'-region" + /> + + <param name="show_sw" type="boolean" checked="True" + truevalue="--show-sw" falsevalue="" + argument="show-sw" + help="Show the influence of structure weight." + /> + + <param name="rev_compl" type="boolean" checked="False" + truevalue="--revcompl" falsevalue="" + argument="revcompl" + help="Plot and fit a reverse complement." + /> + + <param argument="beta" help="Inverse temperature for fitting." + type="float" value="12.0" min="1.0" max="25.0" /> + + <param name="structure_weight" argument="structure-weight" + type="float" value="1.0" min="0.0" max="8.0" + help="Weight of structure against sequence (1.0 means equal)" + /> + + <param argument="offset" help="Genomic offset." + type="integer" value="1" /> + + <param name="signals" type="text" label="List of signals" + help="List of '{from to} orientation' signal specifications. Show signals in plot + and compared infered signal to them. Ranges 'from to' can be repeated; + the orientation must be either +1 or -1. + The specifications of the single signals are separated by ';'. Example of two signal, + where the first one consists of two ranges: 1 15 20 30 +1; 15 45 -1" + > + <sanitizer invalid_char=" "> + <valid initial="string.digits"> <add value="+" /> <add value="-" /> <add value=";" /> </valid> + </sanitizer> + </param> + + <param name="output_format" type="select" + label="Output options"> + <option value="pdf" selected="True">Plot in pdf + format</option> + <option value="png" selected="False">Plot in png format</option> + </param> + + <param name="write_rscript" type="boolean" argument="write-R-script" + label="Write R script" checked="False" + help="Write R script that can produce the output plot." + /> + + <param name="write_subsequence" type="boolean" argument="write-subseq" + label="Write Subsequence" checked="False" + help="Write subsequence in output." + /> + + </inputs> + + + <outputs> + <data format="pdf" name="pdf_output_plot" + label="${tool.name} reliability plot (pdf) ${on_string}"> + <filter>output_format == 'pdf'</filter> + </data> + <data format="png" name="png_output_plot" + label="${tool.name} reliability plot (png) ${on_string}"> + <filter>output_format == 'png'</filter> + </data> + <data format="txt" name="rscript_output" + label="${tool.name} reliability plot (R script) ${on_string}"> + <filter> write_rscript is True </filter> + </data> + <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}" /> + </outputs> + + <tests> + <test> + <param name="input_archive" value="archaea.tar.gz" /> + <param name="write_rscript" value="True" /> + <output name="rscript_output" file="archaea_relplot.scr" lines_diff="2" /> + </test> + </tests> + + <help><![CDATA[**Reliability Profiles for Multiple RNA +Alignment** + +This tool draws reliability profiles for mlocarna alignments that have +been computed in probabilistic alignment mode. Moreover, it predicts +reliably aligned regions, which can be used to determine the +boundaries of well conserved structured RNA motifs in less closely +related sequence context. + +**Input.** +Results archive of an alignment by the mlocarna tool; for this +purpose, mlocarna must be run in probabilistic mode in order to +generate the required reliability information. + +**Output.** +Plot of the reliability profile for the input alignment. Moreover, +a signal prediction is performed and predicted regions are +annotated in the plot. + + +For more information, see +.. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/ + ]]></help> + + <expand macro="citations" /> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,178 @@ +<macros> + <token name="@VERSION@">1.9.0</token> + + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">locarna</requirement> + </requirements> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + </stdio> + </xml> + + <xml name="version"> + <version_command> + <![CDATA[ + mlocarna --version + ]]> + </version_command> + </xml> + + <xml name="bed_anchors"> + <conditional name="bed_anchors"> + <param name="bed_anchors_selector" type="select" label="Anchor constraints" + help="Anchor constraints in bed format specify positions of + named anchor regions per sequence. The sequence names + ('contig' names have to correspond to the fasta input + sequence names. Anchor names must be unique per sequence + and regions of the same name for different sequences + must have the same length. This constrains the alignment + to align all regions of the same name."> + <option value="no">Don't load anchor constraints from bed file</option> + <option value="yes">Load anchor constraints from bed file</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="bed_anchors_file" type="data" format="tabular" + label="Anchor constraint specification in bed format" + /> + </when> + </conditional> + </xml> + + <xml name="common_scoring_parameters"> + <param name="struct_weight" argument="struct-weight" + label="Structure weight" type="integer" + value="200" min="0" max="800" /> + <param name="indel_opening" argument="indel-opening" + label="Indel opening score" type="integer" + value="-500" max="0" min="-1500" /> + <param argument="indel" label="Indel score" type="integer" + value="-350" min="-1000" max="0" /> + <param argument="tau" type="integer" value="50" + min="0" max="200" + label="Sequence contribution at structure match in percent"/> + + <conditional name="sequence_score"> + <param name="sequence_score_selector" type="select" label="Type of sequence score contribution"> + <option value="ribofit">Use ribofit</option> + <option value="ribosum">Use RIBOSUM85_60</option> + <option value="match">Simple match/mismatch costs</option> + </param> + <when value="ribofit" /> + <when value="ribosum" /> + <when value="match"> + <param name="match" type="integer" value="50" + min="0" max="400" + label="Match score" /> + <param name="mismatch" type="integer" value="0" + min="-400" max="0" + label="Mismatch score" /> + </when> + </conditional> + </xml> + + <xml name="plfolding_parameters"> + <param name="plfold_span" argument="--plfold-span" + type="integer" value="150" min="-1" max="400" + label="Maximum basepair span by RNAplfold (local folding); -1 for global folding" /> + + <param name="plfold_winsize" argument="--plfold-winsize" + type="integer" value="300" min="-1" max="800" + label="Window size for local folding" /> + </xml> + + <xml name="common_folding_parameters"> + <param name="rnafold_temperature" argument="rnafold-temperature" + type="float" value="37.0" min="10" max="50" + label="Temperature for RNAfold (RNAfold's -T option)" /> + </xml> + + <xml name="common_heuristic_parameters"> + <param name="min_prob" argument="min-prob" type="float" value="0.0005" + min="0.0" max="0.2" + label="Minimal / cutoff probability" /> + + <param name="max_diff_am" argument="max-diff-am" + type="integer" value="30" + min="-1" max="300" + label="Maximal difference for sizes of matched arcs (-1=off)" /> + + <param name="max_diff" argument="max-diff" type="integer" + value="60" min="-1" max="300" + label="Maximal difference for alignment traces (-1=off)" /> + + <param name="max_diff_at_am" argument="max-diff-am" type="integer" + value="-1" min="-1" max="300" + label="Maximal difference for alignment traces, only at arc match positions" /> + + <param name="max_bps_length_ratio" argument="max-bps-length-ratio" + type="float" value="0.0" min="0.0" max="1.0" + label="Maximal ratio of #base pairs divided by sequence length (default: no effect)" /> + </xml> + + <xml name="alifold_consensus_parameter"> + <param name="alifold_consensus_dp" argument="alifold-consensus-dp" + type="boolean" checked="false" + truevalue="--alifold-consensus-dp" falsevalue="" + label="Compute consensus dot plot by alifold" /> + </xml> + + <xml name="constraints"> + <param name="lonely_pairs" type="boolean" truevalue="--LP" falsevalue="--noLP" + checked="false" label="Allow lonely base-pairs" help="(--LP/--noLP)" /> + <param name="maxBPspan" argument="--maxBPspan" + type="integer" value="-1" min="-1" max="400" + label="Maximum basepair span by RNAfold; -1 for arbitrary span" /> + <param name="ignore_constraints" argument="ignore-constraints" + type="boolean" checked="false" truevalue="--ignore-constraints" falsevalue="" + help="Ignore all anchor and structure constraints given + in the fasta(-ish) input." /> + </xml> + + <xml name="common_other_parameters"> + </xml> + + <xml name="common_outputs"> + <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}"> + <filter>stdout_verbosity != '--quiet'</filter> + </data> + <data format="clustal" name="clustal" from_work_dir="mlocarna_results/results/result.aln" + label="${tool.name} alignment (annotated clustal) on ${on_string}"> + <filter>'clustal' in outputs</filter> + </data> + <data format="clustal" name="clustal_strict" + from_work_dir="mlocarna_results/results/result.strict-aln" + label="${tool.name} alignment (clustal) on ${on_string}"> + <filter>'clustal_strict' in outputs</filter> + </data> + <data format="stockholm" name="stockholm" from_work_dir="mlocarna_results/results/result.stk" + label="${tool.name} alignment (stockholm) on ${on_string}"> + <filter>'stockholm' in outputs</filter> + </data> + <data format="txt" name="pp" + from_work_dir="mlocarna_results/results/result.pp" + label="${tool.name} alignment (PP 2.0) on ${on_string}"> + <filter>'pp' in outputs</filter> + </data> + <data format="tar.gz" name="mlocarna_results_tgz" + label="${tool.name} results archive on ${on_string}"> + <filter>'mlocarna_results' in outputs</filter> + </data> + </xml> + + <xml name="citations"> + <citations> + <citation + type="doi">10.1371/journal.pcbi.0030065</citation> + <citation type="doi">10.1261/rna.029041.111</citation> + </citations> + </xml> + + + +</macros> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea-default.stdout Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,18 @@ +mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0 +Copyright Sebastian Will + +Compute pair probs ... +Compute pairwise alignments ... +Perform progressive alignment ... + + + +vhuU AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU- +fwdB AU-GUUGGAGGGGAACCC-GU------------AAGGGACCCUCCAAGAU- +selD UUACGAUGUGCCGAACCCUUU------------AAGGGAGGCACAUCGAAA +hdrA GG--CACCACUCGAAGGC--U------------AAGCCAAAGUGGUG-CU- +vhuD GU--UCUCUCGGGAACCCGUC------------AAGGGACCGAGAGA-AC- +fruA ---CCUCGAGGGGAACCC-GA------------AAGGGACCCGAGAGG--- +fdhA CG-CCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGGCG- + +alifold ((.(((((((((...(((.................))).))))))))))). (-31.59 = -20.01 + -11.58)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea-probabilistic.aln Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,11 @@ +CLUSTAL W --- LocARNA 1.9.0 + + + +selD UUACGAUGUGCCGAACCCUU------------UAAGGGAGGCACAUCGAAA +vhuU AGC-UCACAACCGAACCCAU-------------UUGGGAGGUUGUGAG-CU +fwdB AUG-UUGGAGGGGAACCCGU-------------AAGGGACCCUCCAAG-AU +hdrA GGC-ACC-ACUCGAAGGCU--------------AAGCCAAAGU-GGUG-CU +vhuD GUU-CUC-UCGGGAACCCGU------------CAAGGGACCGA-GAGA-AC +fdhA CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGG-CG +fruA CC-UCG--AGGGGAACCCGA-------------AAGGGACCC--GAGA-GG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea.fa Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,14 @@ +>fruA +CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG +>fdhA +CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG +>vhuU +AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU +>hdrA +GGCACCACUCGAAGGCUAAGCCAAAGUGGUGCU +>vhuD +GUUCUCUCGGGAACCCGUCAAGGGACCGAGAGAAC +>selD +UUACGAUGUGCCGAACCCUUUAAGGGAGGCACAUCGAAA +>fwdB +AUGUUGGAGGGGAACCCGUAAGGGACCCUCCAAGAU
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea_relplot.scr Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,137 @@ +pdf("/tmp/tmp5yxSuG/files/000/dataset_2.dat",width=12,height=4,version="1.4") + +rel <- read.table("mlocarna_results/results/result.bmreliability"); +seqrel <- rel[[2]] +strrel <- rel[[3]] + +if ("" != "") { + seq <- "" + seq <- strsplit(seq,split="") + tab <- unlist(seq)!="-" + + seqrel<-seqrel[tab] + strrel<-strrel[tab] +} + +len<-length(seqrel) + +if (0) { + seqrel<-seqrel[len:1] + strrel<-strrel[len:1] +} + + + +if (1) { + seqrel <- seqrel/1.0 +} + + +totalrel <- seqrel+strrel; + +anno_space<-0.075 + +maxy <- max(c(1,totalrel))+anno_space*(0+1); + + +firstpos <- 1 +lastpos <- 1+len-1 + +if (0) { + the_xlim <- c(lastpos,firstpos) +} else { + the_xlim <- c(firstpos,lastpos) +} + +# set margin +# b, l, t, r +par(mar=c(6,2.5,1,1)) + +# open plot (and draw threshold) +plot(c(0),c(0),type="l", + xlab="",ylab="", + xlim=the_xlim,ylim=c(0,maxy), + yaxp=c(0,1,2)) + +## title inside of plot +legend("topleft","",bty="n") + + +# total reliability +polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,totalrel,0),col=rgb(0.8,0.8,0.9,0.5),lwd=2,border=FALSE) +lines(firstpos:lastpos,totalrel,col="blue",lwd=2) + +# plot structure reliability +polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,strrel,0),col=rgb(0.3,0.3,0.5,0.8),lwd=1,border=FALSE) + + +## draw other signals +signals<-c(); +signal_sizes<-c(); + +signal_starts <- 1:0 + +signal_starts[1]<-1; +if (0>1) { + for (i in 2:0) { + signal_starts[i]<-signal_starts[i-1]+signal_sizes[i-1]*2+1; + } +} + +colors <- c( + rgb(0.6,0.1,0.1,0.9), + rgb(0.6,0.6,0.1,0.9), + rgb(0.1,0.6,0.6,0.9), + rgb(0.6,0.1,0.6,0.9) +); +colors<-c(colors,colors); + +if (0>0) { + + for (i in 1:0) { + orientation <- signals[signal_starts[i]+signal_sizes[i]*2]; + sig_y <- maxy-i*anno_space; + + for (j in 0:(signal_sizes[i]-1)) { + + sig_x <- c(signals[signal_starts[i]+j*2],signals[signal_starts[i]+j*2+1]); + + ## draw arrows + if (orientation!=0) { + the_code <- 1+(orientation+1)/2; + arrows(sig_x[1],sig_y,sig_x[2],sig_y,lwd=4,col=colors[i],code=the_code,angle=20,length=0.15); + } else { + lines(sig_x,c(sig_y,sig_y),lwd=4,col=colors[i]); + } + } + } +} + +#draw inferred on-signal +hit_color <- rgb(0.1,0.6,0.1,0.9) + +if (0!=1) { + + on <- c(0,4,33,44,49); + off <- c(3,20,43,48,51); + + if (length(on)>0) { + for (i in 1:length(on)) { + lines(c(1+on[i],1+off[i]-1),c(maxy,maxy),lwd=7,col=hit_color); + } + } + + ### draw on/off values + if (0) { + lines(c(1,1+len),c(0.0355791,0.0355791),lty=2,lwd=1) + lines(c(1,1+len),c(0.702675,0.702675),lty=2,lwd=1) + } +} + + +signal_names<-c(); + +if (length(signal_names)>0 || (0!=1)) { + legend("bottom",c("LocARNA",signal_names),lwd=7,col=c(hit_color,colors),horiz=TRUE,inset=-0.4); + # ,xpd=TRUE +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA-default.stdout Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,33 @@ +mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0 +Copyright Sebastian Will + +Compute pair probs ... +Compute pairwise alignments ... +Perform progressive alignment ... + + + +ACA7 ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUUCGGAA-AGGG +ACA30 UGGCACUUUCACAG--UUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGU +ACA5 UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAA--GGC +ACA59 GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG-CCCAUGGGUGAC--CCU +#A1 ............................................................ +#A2 ............................................................ + +ACA7 AGGGAAAGCAAGCCUGGCAGAG-GCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCG +ACA30 GCUGAGAGAAAAC---CC-UUG---AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGG +ACA5 UGCCACAGAAACAC--UGUGAC-UCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAG +ACA59 GGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA +#A1 ....AAAAAA.................................................. +#A2 ....123456.................................................. + +ACA7 AUUGGA--AGA---CACU-CUGCG-----ACA +ACA30 CAACUG--UCA---CUCA-AUGGG-----ACA +ACA5 GGAUAA--AUU---UGGU-UACAG-----ACA +ACA59 ACAAUACUUACUCUCGUUGGUGAUAAGGAACA +#A1 .............................BBB +#A2 .............................123 + +alifold .((((((((........((((.(((((((......))))))).))))......))..))) + ))).............((((((.....((.....((((((((((((.....))))))))) + )))......)).....)).))))......... (-61.69 = -33.85 + -27.84)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA.fa Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,21 @@ +>ACA59 +GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGGCCCAUGGGUGACCCUGGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACA +.............................................................xxxxxx...............................................................................xxx #S +.............................................................AAAAAA...............................................................................BBB #1 +.............................................................123456...............................................................................123 #2 + +>ACA7 +ACCUCCUGGGAUCGCAUCUGGAGAGUGCCUAGUAUUCUGCCAGCUUCGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCGAUUGGAAGACACUCUGCGACA +...........................................................xxxxxx...................................................................xxx #S +...........................................................AAAAAA...................................................................BBB #1 +...........................................................123456...................................................................123 #2 +>ACA5 +UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAAGGCUGCCACAGAAACACUGUGACUCAUGGGCCCUGUUCCUGUGUCCCAGGCUCAGGGAUAAAUUUGGUUACAGACA +..............................................................xxxxxx............................................................xxx #S +..............................................................AAAAAA............................................................BBB #1 +..............................................................123456............................................................123 #2 +>ACA30 +UGGCACUUUCACAGUUCCUUCCCCAGGCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAACCCUUGAUUGUAUUCUUGCCCUGGGAUUAUACCAGUGGCAACUGUCACUCAAUGGGACA +..........................................................xxxxxx..........................................................xxx #S +..........................................................AAAAAA..........................................................BBB #1 +..........................................................123456..........................................................123 #2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA_anchor.bed Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,8 @@ +ACA59 61 67 ANANNA +ACA7 59 65 ANANNA +ACA5 62 68 ANANNA +ACA30 58 64 ANANNA +ACA59 146 149 ACA +ACA7 132 135 ACA +ACA5 128 131 ACA +ACA30 122 125 ACA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2-1.fa Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,2 @@ +>D10744 +GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2-2.fa Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,2 @@ +>AF008220 +GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2.aln Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,7 @@ +CLUSTAL W --- LocARNA 1.9.0 --- Score: 2875 + +D10744 GGAAAAUU-GAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGG +AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGG-----------UCG + +D10744 UGAGUUCGAAUCUCACAUUUUCCG +AF008220 GCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_5.fa Wed Dec 28 18:52:45 2016 -0500 @@ -0,0 +1,10 @@ +>D10744 +GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG +>AF008220 +GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA +>Z11880 +GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG +>X02172 +GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA +>M68929 +GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC