Mercurial > repos > rnateam > viennarna_rnaplfold

changeset 0:22e8485bc5f3 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
author rnateam
date Wed, 20 Dec 2017 08:30:44 -0500
parents
children
files macros.xml rnafold_SHAPE.py rnaplfold.xml test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps test-data/kinfold_input.txt test-data/mfe_struct_result.fasta test-data/rna2dfold_input1.txt test-data/rna2dfold_result1.txt test-data/rnaaliduplex_input1.clustal test-data/rnaaliduplex_result1.txt test-data/rnaalifold_input1.clustal test-data/rnaalifold_input1.fa test-data/rnaalifold_input1.stk test-data/rnaalifold_result1.txt test-data/rnaalifold_result_MEA.txt test-data/rnaalifold_resultfa.txt test-data/rnaalifold_resultstk.txt test-data/rnacofold_input1.fas test-data/rnacofold_result1.txt test-data/rnadistance_input1.dbn test-data/rnadistance_result1.txt test-data/rnaduplex_input1.fa test-data/rnaduplex_result1.txt test-data/rnaeval_input1.dbn test-data/rnaeval_result1.txt test-data/rnafold_input1.fa test-data/rnafold_input2.fa test-data/rnafold_result1.txt test-data/rnafold_result1_mea.txt test-data/rnafold_result1_pf.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/rnaheat_input1.fa test-data/rnaheat_result1.txt test-data/rnainverse_input1.clu test-data/rnalalifold_input1.clustal test-data/rnalalifold_result1.txt test-data/rnalfold_input1.fa test-data/rnalfold_result1.txt test-data/rnapaln_input1.fa test-data/rnapaln_input1.fas test-data/rnapaln_result1.txt test-data/rnapdist_input1.fa test-data/rnapdist_result1.txt test-data/rnapkplex_input1.fa test-data/rnapkplex_result1.txt test-data/rnaplex_input1.fa test-data/rnaplex_result1.txt test-data/rnaplfold_input1.fa test-data/rnaplfold_result1.ps test-data/rnaplfold_result2.ps test-data/rnaplot_input1.dbn test-data/rnaplot_input1.fa test-data/rnasnoop_input1a.fa test-data/rnasnoop_input1b.fa test-data/rnasnoop_result1.txt test-data/rnasubopt_input1.fa test-data/rnasubopt_result1.txt test-data/rnaup_input1.fa test-data/rnaup_result1.txt test-data/sample_3.fa test-data/sample_3.react test-data/sample_3_result.txt test-data/test_sequence_input.fasta test-data/trajectory_result.tabular vienna_rna.tar.gz
diffstat 69 files changed, 2809 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,27 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="2.2.10">viennarna</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <token name="@VERSION@">2.2.10</token>
+    <xml name="version_command">
+        <version_command>@EXECUTABLE@ --version</version_command>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+        </stdio>
+    </xml>
+
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/1748-7188-6-26</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rnafold_SHAPE.py	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,45 @@
+### overcoming the problem of SHAPE data working with a single line.
+### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every
+### single sequence.
+
+import os
+import sys
+from os import system
+from Bio import SeqIO
+import re
+from subprocess import Popen, PIPE
+
+params_list = sys.argv[1:]
+param_list_no_shape = [s for s in params_list if not "--shape=" in s ]
+shape_file = [s for s in params_list if "--shape=" in s ]
+assert (len(shape_file) == 1)
+
+shape_file = shape_file[0]
+shape_file = shape_file.replace('--shape=', '')
+
+params_no_shape  =  " ".join(str(x) for x in param_list_no_shape)
+
+pattern = re.compile("^>.*$")
+id_line = ""
+with open(shape_file, 'r') as f:
+    content = f.read()
+    lines = content.split('\n')
+    for line in lines:
+        if pattern.match(line):
+            id_line = line.split()[0]
+            id_line = id_line[1:]
+            continue
+        else:
+            with open(id_line +'.tmp', "a") as clFile:
+                clFile.write(line + "\n")
+                
+input_file = sys.stdin
+
+for record in SeqIO.parse(input_file, "fasta"):
+    seq = ">{}\n{}".format(record.id,record.seq)
+    cmd =  " RNAfold  --shape=" + record.id + '.tmp ' + params_no_shape
+    p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE)
+    out,err = p.communicate(seq.encode())
+    if err:
+        raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err))
+    print (out.decode('utf-8').strip())
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rnaplfold.xml	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,125 @@
+<tool id="viennarna_rnaplfold" name="@EXECUTABLE@" version="@VERSION@.0">
+    <description> predicts RNA secondary structures including pseudoknots</description>
+
+    <macros>
+        <token name="@EXECUTABLE@">RNAplfold</token>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <expand macro="version_command" />
+    <command>
+<![CDATA[
+    RNAplfold < '$input'
+    -T$temperature
+    --dangles=$dangling
+    --cutoff=$cutoff
+    --winsize=$winsize
+    --span=$span
+    $onthefly
+    $openingenergies
+    #if $varExists('$unpairedOption.ulength')
+        --ulength=$unpairedOption.ulength
+    #end if
+    #if $varExists('$advancedOptions.nolp')
+        $advancedOptions.noconversion
+        $advancedOptions.nolp
+        $advancedOptions.nogu
+        $advancedOptions.noclosinggu
+        $advancedOptions.notetra
+    #end if
+    && find -name '*_basepairs' -or -name '*_lunp' -or -name '*_openen*' > files.tmp 
+    && tar -cf '$outputf' --files-from=files.tmp
+
+]]>
+    </command>
+
+    <inputs>
+        <param format="fasta" name="input" type="data" label="Fasta file"/>
+        <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/>
+        <param name="dangling" type="select" label="how to treat dangling end energies" help="-d">
+            <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option>
+            <option value="0">ignore dangling ends (0)</option>
+            <option value="1">unpaired bases participate in one dangling end only (1)</option>
+            <option value="3">allow coaxial stacking (3)</option>
+        </param>
+        <param name="winsize" type="integer" value="70" label="Average pairing probabilities over this windowsize" help="--winsize"/>
+        <param name="span" type="integer" value="70" label="Maximum seperation between base pairs" help="--span, -L"/>
+        <param name="cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing" help="--cutoff"/>
+        <param name="onthefly" type="boolean" truevalue="--print_onthefly" falsevalue="" checked="false" label="Print simplified base pair probabilities (_basepairs output)" help="--print_onthefly"/>
+        <param name="openingenergies" type="boolean" truevalue="--opening_energies" falsevalue="" checked="false" label="Output in logarithm of the probabilities (_openen output)" help="--opening_energies"/>
+        <param argument="--plex_output" type="boolean" truevalue="--plex_output" falsevalue="" checked="false" label="" help=""/>
+        <conditional name="unpairedOption">
+            <param name="unpairedSelector" type="select" label="Compute probabilty that region is unpaired (_lunp output)">
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="yes">
+                <param name="ulength" type="integer" value="31" label="Maximal lenght of unpaired region" help="--ulength"/>
+            </when>
+            <when value="no">
+            </when>
+        </conditional>
+        <conditional name="advancedOptions">
+            <param name="advancedSelector" type="select" label="advanced options">
+                <option value="basic">basic Options</option>
+                <option value="advanced">advanced Options</option>
+            </param>
+            <when value="advanced">
+                <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/>
+                <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/>
+                <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/>
+                <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/>
+                <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/>               
+            </when>
+            <when value="basic">
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <collection name="matrix_outputs" type="list" label="rna_eps outputs">
+            <discover_datasets pattern="(?P&lt;designation&gt;.+)_dp\.ps" ext="rna_eps" visible="true"/>
+        </collection>
+        <data format="tar" name="outputf"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="rnaplfold_input1.fa"/>
+            <output_collection name="matrix_outputs" type="list">                
+                <element name="Anolis_caro_chrUn_GL343590.trna2-A">
+                    <assert_contents>
+                        <has_text_matching expression="%%Creator: ViennaRNA-@VERSION@" />
+                    </assert_contents>
+                </element>
+            </output_collection>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+
+**RNAplfold**
+
+Computes local pair probabilities for base pairs with a maximal span of L. The probabilities are averaged over all windows of size L that contain the base pair. For a sequence of length n and a window size of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short stable RNA structures.
+
+
+-----
+
+**Input format**
+
+RNAPplfold requires one input file
+
+- Fasta file
+
+------
+
+**Outputs**
+
+For each structure in the Fasta input a postscript image with dot-plot of the pairing probabilities is generated. Different output is generated with the "--ulength", "--print_onthefly" and "--opening_energies" flags.
+The Dot Plot Matrices are stored in a Postscript file.
+The other output is packed in a tar file.
+
+
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,370 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uHmotif{ % i j uHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/lHmotif{ % i j lHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uImotif{ % i j k l uImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+  5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+/lImotif{ % i j k l lImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+  5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 71 0.011137621 ubox
+1 72 0.998618513 ubox
+2 70 0.011249479 ubox
+2 71 0.999343269 ubox
+2 72 0.029380302 ubox
+3 69 0.016278852 ubox
+3 70 0.998657995 ubox
+3 71 0.029349731 ubox
+3 72 0.013044031 ubox
+4 68 0.015570075 ubox
+4 69 0.999660285 ubox
+4 70 0.006500567 ubox
+4 71 0.013063530 ubox
+5 67 0.017184802 ubox
+5 68 0.995393993 ubox
+5 70 0.012116272 ubox
+6 20 0.003683136 ubox
+6 47 0.007871866 ubox
+6 67 0.961997835 ubox
+6 68 0.010641824 ubox
+7 19 0.003963646 ubox
+7 22 0.016669769 ubox
+7 23 0.006395271 ubox
+7 26 0.010803708 ubox
+7 45 0.003325342 ubox
+7 46 0.008388346 ubox
+7 66 0.889354167 ubox
+8 18 0.004993356 ubox
+8 21 0.043576199 ubox
+8 22 0.009051039 ubox
+8 23 0.003412982 ubox
+8 26 0.053349931 ubox
+8 44 0.006391561 ubox
+8 45 0.009575801 ubox
+8 46 0.006511628 ubox
+8 48 0.044296110 ubox
+8 66 0.051228716 ubox
+9 17 0.005076838 ubox
+9 20 0.044973880 ubox
+9 47 0.045851242 ubox
+9 67 0.006907131 ubox
+10 20 0.031947572 ubox
+10 25 0.993218795 ubox
+10 47 0.003684611 ubox
+10 61 0.005362683 ubox
+11 18 0.045881626 ubox
+11 19 0.032788757 ubox
+11 22 0.010762380 ubox
+11 24 0.996351171 ubox
+11 43 0.031784396 ubox
+11 45 0.044997253 ubox
+11 46 0.003273388 ubox
+11 60 0.005393685 ubox
+12 18 0.028759750 ubox
+12 19 0.007591504 ubox
+12 21 0.010602364 ubox
+12 23 0.996289342 ubox
+12 42 0.031993047 ubox
+12 44 0.044989514 ubox
+12 58 0.005409282 ubox
+13 18 0.016589428 ubox
+13 19 0.009128152 ubox
+13 22 0.996158882 ubox
+13 41 0.032010508 ubox
+13 43 0.044839517 ubox
+13 57 0.005483356 ubox
+14 20 0.079642667 ubox
+14 56 0.005446527 ubox
+15 20 0.129735024 ubox
+15 55 0.005085787 ubox
+16 20 0.018529841 ubox
+16 38 0.051862141 ubox
+17 21 0.010497970 ubox
+17 26 0.003797728 ubox
+17 37 0.052295806 ubox
+17 39 0.003520191 ubox
+17 42 0.004660118 ubox
+17 52 0.004889289 ubox
+18 25 0.005375323 ubox
+18 36 0.051745231 ubox
+18 38 0.003387544 ubox
+19 25 0.004215070 ubox
+19 36 0.018363451 ubox
+19 40 0.005479857 ubox
+19 50 0.005352275 ubox
+20 24 0.003956630 ubox
+20 34 0.049426221 ubox
+20 35 0.019676299 ubox
+20 39 0.005488315 ubox
+20 49 0.005308891 ubox
+21 33 0.037607150 ubox
+21 38 0.005407841 ubox
+22 32 0.023047831 ubox
+22 33 0.039236028 ubox
+23 32 0.049874318 ubox
+23 47 0.036867639 ubox
+24 31 0.055184372 ubox
+24 47 0.041474959 ubox
+25 30 0.055108050 ubox
+25 41 0.003625640 ubox
+25 45 0.072422399 ubox
+25 46 0.047506335 ubox
+26 36 0.020612775 ubox
+26 40 0.011634581 ubox
+26 47 0.044476135 ubox
+27 35 0.020631543 ubox
+27 39 0.011645626 ubox
+27 43 0.992061337 ubox
+27 45 0.025461226 ubox
+27 46 0.039850990 ubox
+28 34 0.019643833 ubox
+28 42 0.996960401 ubox
+28 44 0.021374269 ubox
+28 45 0.024434496 ubox
+29 41 0.997917003 ubox
+29 43 0.018395309 ubox
+29 45 0.003166236 ubox
+30 36 0.012434123 ubox
+30 40 0.998065717 ubox
+30 47 0.007404570 ubox
+31 35 0.012393915 ubox
+31 39 0.997764981 ubox
+31 41 0.005414838 ubox
+31 43 0.003645699 ubox
+31 46 0.007622516 ubox
+32 37 0.068093187 ubox
+32 39 0.013599795 ubox
+32 42 0.003678913 ubox
+32 45 0.007610493 ubox
+33 37 0.102337630 ubox
+33 39 0.003720007 ubox
+33 41 0.003538594 ubox
+33 44 0.007538047 ubox
+34 38 0.013851913 ubox
+36 41 0.007501659 ubox
+38 48 0.018700348 ubox
+39 47 0.020533473 ubox
+40 46 0.020625702 ubox
+44 68 0.005576608 ubox
+44 70 0.006111196 ubox
+45 50 0.003800521 ubox
+45 62 0.010043051 ubox
+45 65 0.003484260 ubox
+45 67 0.009783316 ubox
+45 68 0.032579696 ubox
+45 69 0.007408521 ubox
+46 61 0.010086460 ubox
+46 65 0.005780351 ubox
+46 67 0.077112938 ubox
+46 68 0.006873266 ubox
+47 60 0.010092967 ubox
+47 64 0.003785455 ubox
+47 66 0.084736602 ubox
+48 59 0.008724857 ubox
+48 67 0.019275395 ubox
+49 65 0.998806957 ubox
+50 57 0.009062054 ubox
+50 64 0.999848265 ubox
+51 56 0.007052370 ubox
+51 62 0.010700667 ubox
+51 63 0.999834583 ubox
+52 61 0.014860342 ubox
+52 62 0.999778783 ubox
+52 63 0.005533111 ubox
+53 61 0.998254922 ubox
+53 62 0.007658167 ubox
+54 59 0.156536412 ubox
+55 60 0.324268739 ubox
+56 60 0.024269416 ubox
+1 72 0.9500000 lbox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,231 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) def
+/coor [
+[111.04756165 225.82804871]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[126.03404999 225.19142151]
+[129.04023743 244.33856201]
+] def
+/pairs [
+[1 72]
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,507 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uHmotif{ % i j uHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/lHmotif{ % i j lHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uImotif{ % i j k l uImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+  5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+/lImotif{ % i j k l lImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+  5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 6 0.004632238 ubox
+1 9 0.006654223 ubox
+1 14 0.116131258 ubox
+1 15 0.005506901 ubox
+1 30 0.009716645 ubox
+1 34 0.073740324 ubox
+1 37 0.006701873 ubox
+1 64 0.004871484 ubox
+1 73 0.570925214 ubox
+2 8 0.007083382 ubox
+2 11 0.008406236 ubox
+2 12 0.007044803 ubox
+2 13 0.129102832 ubox
+2 27 0.003166551 ubox
+2 29 0.016103198 ubox
+2 31 0.059809132 ubox
+2 32 0.018860727 ubox
+2 33 0.080458349 ubox
+2 36 0.007548805 ubox
+2 63 0.005718318 ubox
+2 69 0.007556179 ubox
+2 70 0.028650384 ubox
+2 71 0.546628270 ubox
+2 72 0.773685839 ubox
+3 7 0.004749417 ubox
+3 11 0.010358730 ubox
+3 12 0.129015255 ubox
+3 13 0.003933689 ubox
+3 28 0.016108727 ubox
+3 29 0.005358837 ubox
+3 31 0.020535925 ubox
+3 32 0.083122889 ubox
+3 62 0.005713974 ubox
+3 68 0.006646921 ubox
+3 69 0.031485159 ubox
+3 70 0.558919532 ubox
+3 71 0.770984265 ubox
+3 72 0.215962264 ubox
+4 8 0.003846249 ubox
+4 11 0.128681370 ubox
+4 13 0.011210848 ubox
+4 25 0.004019121 ubox
+4 27 0.015919907 ubox
+4 28 0.004907639 ubox
+4 29 0.064014656 ubox
+4 31 0.083429550 ubox
+4 61 0.005688924 ubox
+4 67 0.004381706 ubox
+4 68 0.030984314 ubox
+4 69 0.928667711 ubox
+4 70 0.171363563 ubox
+4 71 0.216620666 ubox
+4 72 0.007349484 ubox
+5 12 0.010780540 ubox
+5 28 0.062660548 ubox
+5 47 0.006856414 ubox
+5 67 0.030480480 ubox
+5 68 0.927409033 ubox
+5 70 0.201662161 ubox
+6 17 0.003163375 ubox
+6 20 0.004307680 ubox
+6 28 0.008183017 ubox
+6 47 0.073508582 ubox
+6 50 0.015670251 ubox
+6 59 0.003724079 ubox
+6 67 0.895370856 ubox
+6 68 0.033940401 ubox
+6 70 0.008321205 ubox
+7 16 0.003361849 ubox
+7 19 0.004518445 ubox
+7 22 0.015784771 ubox
+7 23 0.006061468 ubox
+7 26 0.014487017 ubox
+7 44 0.005844573 ubox
+7 45 0.012806982 ubox
+7 46 0.076342752 ubox
+7 48 0.020848970 ubox
+7 49 0.018126701 ubox
+7 58 0.004549362 ubox
+7 66 0.827624872 ubox
+8 15 0.003431379 ubox
+8 18 0.005204581 ubox
+8 21 0.036410380 ubox
+8 22 0.007907851 ubox
+8 26 0.044491013 ubox
+8 44 0.019732249 ubox
+8 45 0.085065889 ubox
+8 46 0.073831467 ubox
+8 48 0.244628685 ubox
+8 57 0.004318992 ubox
+8 64 0.004391699 ubox
+8 66 0.049191061 ubox
+9 17 0.005251011 ubox
+9 20 0.037521120 ubox
+9 47 0.253722300 ubox
+9 67 0.010690853 ubox
+9 68 0.010096246 ubox
+9 70 0.004399209 ubox
+10 20 0.026215970 ubox
+10 25 0.829289356 ubox
+10 36 0.006465083 ubox
+10 47 0.027737796 ubox
+10 63 0.004597663 ubox
+10 65 0.005017003 ubox
+10 67 0.005447271 ubox
+10 69 0.005544437 ubox
+11 18 0.038327522 ubox
+11 19 0.026908727 ubox
+11 22 0.008733209 ubox
+11 24 0.831795780 ubox
+11 35 0.006471634 ubox
+11 43 0.468132693 ubox
+11 45 0.252989051 ubox
+11 46 0.024187195 ubox
+12 18 0.023602891 ubox
+12 19 0.006232645 ubox
+12 21 0.008604981 ubox
+12 23 0.831740817 ubox
+12 34 0.006375561 ubox
+12 42 0.472749007 ubox
+12 44 0.251590986 ubox
+12 45 0.014945041 ubox
+13 18 0.013723928 ubox
+13 19 0.007497427 ubox
+13 22 0.831631273 ubox
+13 39 0.003427828 ubox
+13 41 0.473909293 ubox
+13 43 0.250370719 ubox
+14 20 0.066488520 ubox
+14 38 0.003182944 ubox
+14 40 0.457844605 ubox
+15 20 0.108308493 ubox
+15 38 0.011419523 ubox
+15 40 0.051301522 ubox
+16 20 0.015471478 ubox
+16 38 0.470000855 ubox
+16 40 0.178550335 ubox
+17 21 0.008767749 ubox
+17 26 0.003387803 ubox
+17 37 0.496886199 ubox
+17 39 0.177094176 ubox
+17 73 0.045173900 ubox
+18 25 0.004902375 ubox
+18 36 0.492816130 ubox
+18 38 0.121851863 ubox
+18 72 0.055748796 ubox
+19 25 0.003883170 ubox
+19 36 0.239923237 ubox
+19 38 0.005417278 ubox
+19 71 0.055691551 ubox
+20 24 0.003644610 ubox
+20 34 0.470810526 ubox
+20 35 0.247657199 ubox
+20 37 0.005831255 ubox
+21 32 0.009783764 ubox
+21 33 0.358241990 ubox
+21 70 0.054635624 ubox
+22 29 0.006362768 ubox
+22 31 0.013177914 ubox
+22 32 0.219551670 ubox
+22 33 0.403084545 ubox
+22 68 0.003789411 ubox
+22 69 0.055392027 ubox
+23 28 0.006024870 ubox
+23 32 0.500859862 ubox
+23 33 0.004324443 ubox
+23 47 0.031904991 ubox
+23 67 0.003787974 ubox
+23 68 0.052636256 ubox
+24 29 0.008474011 ubox
+24 31 0.549100761 ubox
+24 47 0.049197557 ubox
+24 67 0.030536001 ubox
+25 30 0.548338702 ubox
+25 41 0.004144135 ubox
+25 45 0.067140277 ubox
+25 46 0.053750180 ubox
+26 36 0.057394616 ubox
+26 40 0.012772171 ubox
+26 47 0.064315077 ubox
+26 50 0.004714852 ubox
+27 35 0.057448226 ubox
+27 39 0.013170691 ubox
+27 43 0.815569764 ubox
+27 45 0.049009957 ubox
+27 46 0.063413875 ubox
+27 49 0.005262423 ubox
+27 53 0.004564973 ubox
+28 34 0.054697757 ubox
+28 42 0.820379890 ubox
+28 44 0.048191892 ubox
+28 45 0.035895579 ubox
+28 46 0.029285776 ubox
+28 48 0.006599916 ubox
+28 52 0.004579520 ubox
+29 41 0.821245880 ubox
+29 43 0.046763735 ubox
+29 45 0.057920583 ubox
+29 46 0.006457134 ubox
+29 51 0.004606001 ubox
+30 36 0.024024302 ubox
+30 40 0.821070294 ubox
+30 47 0.027558338 ubox
+30 50 0.004615290 ubox
+31 35 0.023900118 ubox
+31 39 0.821259198 ubox
+31 41 0.031662456 ubox
+31 43 0.068739658 ubox
+31 45 0.005088084 ubox
+31 46 0.028387067 ubox
+31 49 0.004618779 ubox
+32 37 0.056070394 ubox
+32 39 0.007808716 ubox
+32 41 0.004679327 ubox
+32 42 0.069668252 ubox
+32 44 0.005113833 ubox
+32 45 0.028339924 ubox
+32 48 0.003694275 ubox
+33 37 0.084188349 ubox
+33 39 0.012554387 ubox
+33 41 0.069738589 ubox
+33 43 0.004988753 ubox
+33 44 0.028077519 ubox
+33 48 0.005052659 ubox
+34 38 0.015647295 ubox
+34 40 0.068716940 ubox
+34 47 0.005883003 ubox
+35 72 0.003223293 ubox
+36 41 0.028025736 ubox
+36 45 0.006071525 ubox
+37 47 0.004492398 ubox
+37 67 0.004929165 ubox
+38 46 0.004623641 ubox
+38 66 0.005612639 ubox
+38 73 0.096471321 ubox
+39 65 0.006372388 ubox
+39 72 0.134387529 ubox
+40 64 0.006366003 ubox
+40 73 0.044296160 ubox
+41 63 0.006315212 ubox
+41 71 0.157425382 ubox
+41 72 0.055795571 ubox
+42 47 0.003279277 ubox
+42 70 0.158258676 ubox
+43 63 0.003504831 ubox
+43 69 0.159460464 ubox
+43 71 0.083592343 ubox
+43 72 0.004963441 ubox
+44 67 0.003632562 ubox
+44 68 0.157762054 ubox
+44 70 0.122775573 ubox
+45 56 0.003216980 ubox
+45 62 0.033079448 ubox
+45 63 0.006333865 ubox
+45 65 0.005683413 ubox
+45 67 0.142807045 ubox
+45 68 0.102004762 ubox
+45 69 0.139542279 ubox
+45 70 0.038496405 ubox
+45 71 0.007227554 ubox
+45 72 0.051023600 ubox
+46 55 0.003223253 ubox
+46 61 0.033233869 ubox
+46 62 0.005934201 ubox
+46 65 0.014068389 ubox
+46 67 0.151344698 ubox
+46 68 0.117431569 ubox
+46 69 0.048110592 ubox
+46 70 0.005932615 ubox
+46 71 0.051023157 ubox
+47 60 0.033207628 ubox
+47 64 0.011567823 ubox
+47 66 0.169443202 ubox
+48 59 0.032419774 ubox
+48 67 0.054982355 ubox
+48 68 0.015912705 ubox
+48 70 0.010752649 ubox
+49 56 0.003800040 ubox
+49 59 0.006023614 ubox
+49 63 0.008508712 ubox
+49 65 0.996813137 ubox
+49 67 0.013145831 ubox
+49 69 0.007555919 ubox
+50 57 0.025044897 ubox
+50 58 0.008142900 ubox
+50 64 0.998396751 ubox
+50 66 0.013239028 ubox
+51 56 0.028984258 ubox
+51 62 0.014992485 ubox
+51 63 0.999154389 ubox
+51 65 0.013340412 ubox
+52 56 0.007696861 ubox
+52 61 0.018442907 ubox
+52 62 0.999085217 ubox
+52 63 0.014927477 ubox
+52 72 0.003975401 ubox
+53 61 0.997430929 ubox
+53 62 0.015882748 ubox
+53 71 0.003986825 ubox
+54 59 0.163009340 ubox
+54 70 0.003908232 ubox
+55 60 0.162646810 ubox
+56 60 0.056948332 ubox
+57 68 0.004617988 ubox
+58 67 0.004981508 ubox
+59 66 0.005078979 ubox
+60 65 0.005070973 ubox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,230 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) def
+/coor [
+[102.34599304 225.12051392]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[134.64427185 223.74850464]
+[127.29573059 238.40902710]
+] def
+/pairs [
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kinfold_input.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+ACUGAUCGUAGUCAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mfe_struct_result.fasta	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>test_seq mfe: -13.6
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
+.(((((((((.......)))))))))........
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_input1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rna2dfold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1>
+.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2>
+k	l	en	structure
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_input1.clustal	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaaliduplex_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))).   1,73  :   1,73  (-40.30)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.clustal	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL34
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL35
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_input1.stk	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,5 @@
+# STOCKHOLM 1.0
+#=GF SQ 2
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_result_MEA.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-26.77]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 +  -0.25 d=1.28}
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 +  -0.25 MEA=70.93}
+ frequency of mfe structure in ensemble 0.773705; ensemble diversity 2.40  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_resultfa.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaalifold_resultstk.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 +  -0.25)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_input1.fas	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnacofold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-A
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_input1.dbn	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnadistance_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+f: 4  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaduplex_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_input1.dbn	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaeval_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_input2.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_mea.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,14 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_pf.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,12 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result2.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result3.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Sequence
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+> comment 1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaheat_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,102 @@
+> comment 1
+0   0.0407267
+1   0.0435052
+2   0.0470227
+3   0.0505646
+4   0.0553391
+5   0.0603894
+6   0.0662047
+7   0.0718158
+8   0.0782007
+9   0.0863514
+10   0.0950516
+11   0.10505
+12   0.115613
+13   0.128245
+14   0.141712
+15   0.157281
+16   0.17497
+17   0.195056
+18   0.216799
+19   0.241743
+20   0.270432
+21   0.302132
+22   0.337644
+23   0.377263
+24   0.421546
+25   0.470799
+26   0.525589
+27   0.587016
+28   0.653829
+29   0.726606
+30   0.806458
+31   0.892656
+32   0.984857
+33   1.08272
+34   1.18601
+35   1.29332
+36   1.40305
+37   1.51467
+38   1.62618
+39   1.73524
+40   1.84032
+41   1.9407
+42   2.03385
+43   2.11859
+44   2.19443
+45   2.26182
+46   2.31999
+47   2.36969
+48   2.41182
+49   2.44826
+50   2.47967
+51   2.50769
+52   2.534
+53   2.55942
+54   2.5851
+55   2.61217
+56   2.64151
+57   2.67329
+58   2.70759
+59   2.74465
+60   2.78458
+61   2.8279
+62   2.8742
+63   2.92425
+64   2.97698
+65   3.03283
+66   3.09163
+67   3.15591
+68   3.23033
+69   3.3067
+70   3.38122
+71   3.45791
+72   3.54606
+73   3.63843
+74   3.73392
+75   3.83847
+76   3.94646
+77   4.05462
+78   4.16571
+79   4.28366
+80   4.39944
+81   4.50863
+82   4.61035
+83   4.70186
+84   4.78345
+85   4.85204
+86   4.90509
+87   4.9392
+88   4.95425
+89   4.95214
+90   4.93688
+91   4.91166
+92   4.87691
+93   4.8314
+94   4.78561
+95   4.75271
+96   4.71866
+97   4.66056
+98   4.57671
+99   4.48395
+100   4.39006
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnainverse_input1.clu	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
+gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_input1.clustal	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalalifold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05)   17 -   73
+((((........)))). ( -5.10)   10 -   26
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnalfold_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,28 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+.((((....)))).	( -0.10)	56
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -7.70)	48
+.((((..(((((.......)))))..)))).	(-10.30)	42
+.(((((...(((((.......))))).))))).	(-11.50)	40
+.((.(((((...(((((.......))))).)))))))	(-12.10)	37
+.(((((.......))))).	( -5.80)	26
+.((.(((((.......)))))..)).	( -6.70)	23
+.((((....)))).	( -3.20)	21
+.((.((((....)))).)).	( -4.70)	18
+.((((........)))).	( -5.30)	9
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).	(-22.00)	1
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+ (-22.00)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.(((..((((....)))).))).	( -3.40)	51
+.(((((.......))))).	( -9.20)	48
+.((((..(((((.......)))))..)))).	(-11.80)	42
+.(((((...(((((.......))))).))))).	(-13.30)	40
+.((.(((((...(((((.......))))).)))))))	(-13.60)	37
+.(((((.......))))).	( -7.70)	26
+.((.(((((.......)))))..)).	( -8.60)	23
+.(((.(((((.(((((.......)))))..)).(((((.......)))))..))))))	(-20.00)	16
+.((((........)))).	( -5.30)	9
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).	(-29.60)	1
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+ (-29.60)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_input1.fas	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,1 @@
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapaln_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+68.8844
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapdist_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+8.66253
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnapkplex_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplex_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70) i:72,j:1 <-41.26>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-A (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-A (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result1.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,242 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1568 ubox
+2 71 0.9619 ubox
+3 69 0.1395 ubox
+3 70 0.7414 ubox
+3 72 0.8060 ubox
+4 68 0.1157 ubox
+4 69 0.6748 ubox
+4 71 0.4682 ubox
+5 67 0.1065 ubox
+5 68 0.6724 ubox
+5 70 0.3765 ubox
+6 47 0.1250 ubox
+6 67 0.6497 ubox
+7 46 0.1273 ubox
+7 66 0.6008 ubox
+8 45 0.1294 ubox
+8 48 0.2252 ubox
+9 47 0.2335 ubox
+10 25 0.7863 ubox
+11 24 0.7884 ubox
+11 43 0.5215 ubox
+11 45 0.2330 ubox
+12 23 0.7883 ubox
+12 42 0.5493 ubox
+12 44 0.2317 ubox
+13 22 0.7882 ubox
+13 41 0.5528 ubox
+13 43 0.2306 ubox
+14 40 0.5338 ubox
+15 20 0.1027 ubox
+16 38 0.5325 ubox
+16 40 0.1646 ubox
+17 37 0.5639 ubox
+17 39 0.1633 ubox
+18 36 0.5591 ubox
+18 38 0.1125 ubox
+19 36 0.2406 ubox
+20 34 0.5341 ubox
+20 35 0.2514 ubox
+21 33 0.4064 ubox
+22 32 0.2491 ubox
+22 33 0.4413 ubox
+23 32 0.5541 ubox
+24 31 0.6100 ubox
+25 30 0.6092 ubox
+26 36 0.2144 ubox
+27 35 0.2146 ubox
+27 43 0.7269 ubox
+28 34 0.2043 ubox
+28 42 0.7445 ubox
+29 41 0.7467 ubox
+30 40 0.7468 ubox
+31 39 0.7470 ubox
+38 73 0.3242 ubox
+39 72 0.3055 ubox
+40 73 0.1211 ubox
+41 71 0.2953 ubox
+41 72 0.1146 ubox
+42 70 0.2588 ubox
+43 69 0.2613 ubox
+43 71 0.2848 ubox
+44 68 0.2587 ubox
+44 70 0.3418 ubox
+45 67 0.2339 ubox
+45 68 0.1772 ubox
+45 69 0.3617 ubox
+45 70 0.1014 ubox
+45 72 0.3111 ubox
+46 67 0.2550 ubox
+46 68 0.3039 ubox
+46 69 0.1150 ubox
+46 71 0.2540 ubox
+47 66 0.2925 ubox
+48 67 0.1378 ubox
+49 65 0.9938 ubox
+50 64 0.9971 ubox
+51 63 0.9980 ubox
+52 62 0.9980 ubox
+53 61 0.9963 ubox
+54 59 0.1628 ubox
+55 60 0.1625 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplfold_result2.ps	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,212 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Oct  4 14:45:55 2016
+%%BoundingBox: 66 530 520 650
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/winSize 70 def
+/len { sequence length } bind def
+
+292 416 translate
+72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+/drawseq_turn {% print sequence at bottom
+   gsave
+   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
+    0 1 len 1 sub {
+     dup dup 2 sqrt mul 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+} bind def
+/drawgrid_turn{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     dup winSize gt
+     {dup dup len exch sub winSize add lineto}
+     {dup len lineto}ifelse
+     dup len exch sub moveto  %moveto diagonal?
+     dup len winSize sub le
+     {dup dup len exch sub dup winSize exch sub len add exch lineto}
+     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
+  } for
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+      dup 1 gt {
+          dup dup 20 div dup 2 array astore exch 40 div setdash
+      } { [0.3 0.7] 0.1 setdash } ifelse
+      0 exch len {    %for (0, gridspacing, len) 
+     dup dup      %duplicate what - gridspacing??
+     dup len exch sub moveto     %moveto diagonal?
+     len exch sub 0.7 sub exch 0.7 sub exch lineto
+     stroke
+   }for
+ winSize len moveto  len winSize  lineto stroke
+  [] 0 setdash
+  0.04 setlinewidth 
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+   stroke
+  } if
+  0.5 neg dup translate
+} bind def 
+
+0.5 dup translate
+drawseq_turn
+45 rotate
+
+
+%draw the grid
+drawgrid_turn
+
+%start of base pair probability data
+2 70 0.1914 ubox
+2 71 0.9787 ubox
+3 69 0.1660 ubox
+3 70 0.7676 ubox
+3 72 0.8449 ubox
+4 68 0.1377 ubox
+4 69 0.7113 ubox
+4 71 0.4928 ubox
+5 67 0.1266 ubox
+5 68 0.7090 ubox
+5 70 0.3955 ubox
+6 67 0.6860 ubox
+7 66 0.6345 ubox
+10 25 0.9888 ubox
+11 24 0.9915 ubox
+12 23 0.9914 ubox
+13 22 0.9913 ubox
+15 20 0.1291 ubox
+17 73 0.1217 ubox
+18 72 0.1091 ubox
+27 43 0.9522 ubox
+28 42 0.9836 ubox
+29 41 0.9874 ubox
+30 40 0.9886 ubox
+31 39 0.9883 ubox
+33 37 0.1014 ubox
+38 73 0.1170 ubox
+39 72 0.1080 ubox
+41 71 0.1523 ubox
+42 70 0.1341 ubox
+43 69 0.1387 ubox
+43 71 0.2800 ubox
+44 68 0.1392 ubox
+44 70 0.3364 ubox
+45 67 0.1266 ubox
+45 68 0.1838 ubox
+45 69 0.3586 ubox
+45 72 0.3252 ubox
+46 67 0.2524 ubox
+46 68 0.3007 ubox
+46 69 0.1142 ubox
+46 71 0.2655 ubox
+47 66 0.2807 ubox
+48 67 0.1394 ubox
+49 65 0.9981 ubox
+50 64 0.9997 ubox
+51 63 0.9997 ubox
+52 62 0.9997 ubox
+53 61 0.9981 ubox
+54 59 0.1565 ubox
+55 60 0.3242 ubox
+showpage
+end
+%%EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.dbn	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,3 @@
+>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaplot_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1a.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>homo
+CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_input1b.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>ACA51
+AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasnoop_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>ACA51
+>homo
+<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 :   8,65  (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) 
+UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnasubopt_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,7 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0]
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0]
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   0.00
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_input1.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,4 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnaup_result1.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+  55,  58 	 (0.019) 	 for u=  4
+RNAup output in file: Anolis_caro_chrUn_GL343590.trna2-AlaAGC_u1.out
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
+  16,  19 	 (0.004) 	 for u=  4
+RNAup output in file: Anolis_caro_chrUn_GL343207.trna3-AlaAGC_u1.out
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.fa	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,6 @@
+>SECIS_1 test
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+>6S_1 test1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3.react	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,447 @@
+>SECIS_1	
+1	0.0657466222
+2	0.1280448842
+3	0.2786665403
+4	0.1391216354
+5	0.0272299574
+6	0.1717063095
+7	0.488732281
+8	3.3015172695
+9	0.414494604
+10	0.1957445189
+11	0.4670328791
+12	0.1943420556
+13	0.2099109521
+14	0.5846784488
+15	0.1296563697
+16	0.0359267698
+17	0.0438238841
+18	1.6364597431
+19	1.72206594665E-17
+20	0.0099928394
+21	0.0475042774
+22	0.0065948845
+23	0.0574522715
+24	0.2126102485
+25	1.2006488448
+26	0.6040825271
+27	0.4114049219
+28	1.1514597937
+29	1.216707413
+30	0.0186005737
+31	0.0841609069
+32	0.086771667
+33	1.1672973211
+34	0.8144419625
+35	0.2583987716
+36	0.0182542709
+37	0.0875979754
+38	0.094456587
+39	0.5206337515
+40	0.000517531
+41	0.0253820905
+42	0.2076338063
+43	0.0087295599
+44	0.0129264641
+45	0.0127365182
+46	0.1193338151
+47	0.0186183812
+48	0.3581141112
+49	0.0941009884
+50	0.2050905673
+51	0.0209195644
+52	0.6030952711
+53	5.2129588113
+54	0.1747678483
+55	1.2231479801
+56	0.4978854319
+57	0.5711590135
+58	0.2793524314
+59	0.0037936012
+60	0.2158137729
+61	0.5646393912
+62	0.6229186627
+63	0.0193621982
+>6S_1	
+1	0.1158690877
+2	0.0774028501
+3	0.2349947573
+4	1.72206594665E-17
+5	0.0926174169
+6	0.0505177415
+7	0.0457131819
+8	0.0194615986
+9	2.1495069267
+10	0.0409639397
+11	0.2185631969
+12	0.1776745985
+13	0.0086422926
+14	0.0241577615
+15	0.0092855631
+16	0.3453240509
+17	0.1535840586
+18	0.0180643958
+19	0.1188776616
+20	0.3091581196
+21	0.3748109806
+22	0.6187506508
+23	0.3511511383
+24	0.6512026704
+25	0.3096370415
+26	0.5283368492
+27	0.7500060952
+28	0.0352720444
+29	0.3776026196
+30	0.3489100484
+31	1.3035405919
+32	0.1023638167
+33	0.133082988
+34	0.0024118398
+35	0.0281166587
+36	0.2818828676
+37	0.1316060603
+38	0.1813992598
+39	0.0047490217
+40	0.0204058553
+41	0.0675891142
+42	0.045119933
+43	0.0266727645
+44	0.0673921107
+45	0.0085752561
+46	0.495476266
+47	0.8224799434
+48	0.5574272341
+49	0.2431151153
+50	0.256015696
+51	0.0386339787
+52	0.6618567864
+53	0.0707284393
+54	1.1215284869
+55	0.0463423016
+56	0.3338809513
+57	0.3987796157
+58	1.1046527917
+59	0.6156154318
+60	0.1179259769
+61	2.0333569471
+62	0.1224421595
+63	0.0266055429
+64	0.0298356423
+65	0.3004015135
+66	2.1966900004
+67	0.0222153137
+68	0.0095300422
+69	0.0503009918
+70	0.0418994997
+71	0.0384566069
+72	2.6211662666
+73	0.1704872628
+74	0.8386436572
+75	0.6961218859
+76	0.1995308419
+77	0.0552442152
+78	0.1937915065
+79	0.1239592493
+80	0.0782601391
+81	0.0138965117
+82	0.0231978646
+83	0.0150709773
+84	0.4084290821
+85	0.0792668417
+86	1.0630476211
+87	0.2524739666
+88	0.0229636507
+89	0.1153934877
+90	0.2693801005
+91	0.0071337145
+92	1.0279231796
+93	0.0574241281
+94	0.103312087
+95	0.2100864561
+96	0.0252070712
+97	0.6067864142
+98	0.0607860625
+99	0.5416948523
+100	0.7090251541
+101	2.0470096713
+102	0.0368697578
+103	0.1221648319
+104	0.0484836208
+105	0.7188621431
+106	0.2405585888
+107	0.1071170724
+108	0.6859305671
+109	0.0997679124
+110	0.0342400356
+111	0.0201635
+112	0.4527960874
+113	0.7018417748
+114	0.2561295384
+115	0.2788440973
+116	0.2437240042
+117	0.0984135237
+118	0.1146045041
+119	0.2116296362
+120	0.0360702095
+121	0.2006613525
+122	0.0635994434
+123	0.8384420629
+124	0.3546527057
+125	0.014380068
+126	0.0041004554
+127	0.2404132813
+128	0.0016204246
+129	0.016365643
+130	0.0025333389
+131	0.0207130798
+132	0.2199275512
+133	0.2973627433
+134	1.7680018464
+135	0.3120917444
+136	0.854288287
+137	0.4309335923
+138	2.3003988746
+139	0.047166557
+140	0.7391255635
+141	0.1357653755
+142	0.4672659386
+143	0.3601080698
+144	0.9111911856
+145	0.7435427597
+146	0.3353115579
+147	1.0513358906
+148	0.1406855309
+149	0.3543459659
+150	0.0561408821
+151	0.563013834
+152	0.1549691284
+153	0.7460309808
+154	0.0486849156
+155	0.1080587915
+156	0.0699642772
+157	0.4423435657
+158	0.0171555252
+159	0.0064557797
+160	0.4739275466
+161	0.2617128164
+162	0.0879369647
+163	0.0062762841
+164	0.1060085461
+165	0.0971932081
+166	0.3139785044
+167	0.0771649003
+168	0.0753029618
+169	0.5676607679
+170	0.9836368904
+171	0.6193661835
+172	0.3890022353
+173	0.3304911731
+174	0.9354752573
+175	2.5683088408
+176	0.6777050636
+177	0.0195000778
+178	0.0532349161
+179	0.0993391181
+180	0.0667310411
+181	0.0123690861
+182	0.0165201319
+183	0.2056431695
+184	0.0114477122
+185	0.1684423923
+186	0.6236165725
+187	0.2533573459
+188	7.4644850979
+189	1.72206594665E-17
+190	0.0510513818
+191	0.071993023
+192	0.093087642
+193	0.026770297
+194	0.1003921418
+195	0.731799564
+196	0.3882654324
+>6S_2	
+1	5.135077189
+2	0.0137794619
+3	0.0198585136
+4	0.0394762621
+5	0.1032256038
+6	0.0124879331
+7	0.050343991
+8	0.0266906427
+9	0.0867862234
+10	0.0250443701
+11	0.1241682715
+12	0.0888505404
+13	1.72206594665E-17
+14	0.0443782398
+15	0.0331749933
+16	1.190843321
+17	0.0083605324
+18	0.1025127456
+19	0.0318835351
+20	0.6764653014
+21	1.6659553696
+22	0.0532195755
+23	0.1306535914
+24	3.2368938797
+25	0.2999875752
+26	0.1771608894
+27	0.0735275063
+28	1.1463641343
+29	0.3436951718
+30	0.6339043401
+31	0.8229568123
+32	0.0567986298
+33	0.3413998482
+34	0.1291037675
+35	0.561127074
+36	0.0076983354
+37	0.147000237
+38	0.0214390185
+39	0.5304305785
+40	0.0785507542
+41	0.0483731004
+42	0.0976091996
+43	1.2125480978
+44	0.1865263845
+45	0.6312459899
+46	0.1817958047
+47	2.8617198725
+48	0.2055922577
+49	1.3068827801
+50	0.2629492567
+51	0.8571308379
+52	0.2726647331
+53	1.129084224
+54	0.275119436
+55	0.5874419445
+56	0.3657294569
+57	0.2500734975
+58	1.0443534711
+59	4.5331285532
+60	0.2551985691
+61	0.1800315837
+62	1.2079574507
+63	0.1377332438
+64	0.034281766
+65	0.0098202871
+66	0.9938878178
+67	0.0331980613
+68	0.2884058117
+69	0.1471099733
+70	0.0250835628
+71	0.0040433138
+72	2.1207460501
+73	0.7413016698
+74	0.2856087978
+75	0.1043896327
+76	2.5426831833
+77	0.024753755
+78	0.0197741979
+79	0.0256614712
+80	0.0931195919
+81	0.2341548619
+82	0.9442989
+83	0.6902004027
+84	0.2615426874
+85	0.1968596889
+86	0.1317761893
+87	0.3101105886
+88	0.3109082689
+89	0.6036478733
+90	0.1383132052
+91	1.72206594665E-17
+92	1.3701244222
+93	0.0259262955
+94	0.0427849321
+95	0.0059202715
+96	0.4620195968
+97	1.1627066739
+98	0.1193652803
+99	0.5039174355
+100	0.7685843498
+101	3.3504451177
+102	0.0156110762
+103	0.0405202895
+104	0.0448853051
+105	0.1130352336
+106	0.0128895533
+107	0.0140152443
+108	0.8487385272
+109	0.5411302314
+110	0.1921994675
+111	0.0804367301
+112	2.1393979849
+113	0.657192459
+114	0.9680746376
+115	0.0181673032
+116	0.1293355582
+117	0.0385348779
+118	0.0599847607
+119	0.0286153267
+120	0.0529816257
+121	0.0738905329
+122	1.9826160191
+123	0.6850277412
+124	0.0240149916
+125	0.1003714264
+126	0.0282377438
+127	0.016091267
+128	0.0654324545
+129	1.3672926211
+130	0.3123897874
+131	0.0125997931
+132	0.0326682275
+133	0.8141700098
+134	2.7208263459
+135	0.9376426669
+136	0.2104407859
+137	0.9213456642
+138	0.9496557623
+139	0.0158974709
+140	1.0394051723
+141	3.395502997
+142	0.2786545217
+143	0.0944673368
+144	0.1658691067
+145	1.5138095878
+146	0.2388473327
+147	0.0071582802
+148	0.0399196127
+149	0.0269685694
+150	0.0343298406
+151	0.0260244978
+152	0.1131275763
+153	0.0217325853
+154	0.1015784545
+155	0.0991349861
+156	1.4195713543
+157	0.5085589945
+158	0.1250938659
+159	0.788081555
+160	0.1135816768
+161	0.0633806979
+162	2.7826494
+163	1.8003487205
+164	0.7686439584
+165	0.0397996113
+166	0.8340757785
+167	0.0060961894
+168	0.0003936337
+169	0.0179660084
+170	0.033466093
+171	0.0469772809
+172	0.1070226766
+173	0.3447929483
+174	0.8559366126
+175	0.1279778477
+176	0.2188243998
+177	0.0449863446
+178	0.0382790499
+179	0.0022221768
+180	0.0311889472
+181	0.0257878168
+182	0.0172539125
+183	0.2710934097
+184	0.0914500662
+185	0.208503114
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_3_result.txt	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,9 @@
+>SECIS_1
+AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
+.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97)
+>6S_1
+GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
+(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38)
+>6S_2
+UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
+.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_sequence_input.fasta	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,2 @@
+>test_seq
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trajectory_result.tabular	Wed Dec 20 08:30:44 2017 -0500
@@ -0,0 +1,10 @@
+..(((....)))	-0.4	0.0550686	3.9	6.46108	12	
+.((((....))))	-3	0.0600001	5.96046e-09	6.46108	13
+(((((....)))))	-4.7	0.065	0	6.46108	14
+(((((....)))))..((((....))))	-5.3	0.135069	3.9	6.46108	28
+(((((....))))).(((((....)))))	-5.8	0.14	1.90735e-07	6.46108	29
+(((((....))))).......(((....)))...	-6.9	0.17246	6.7	7.46108	34
+(((((....)))))......((((....))))..	-7.8	0.17246	9.53674e-08	7.46108	34
+(((((....))))).....(((((....))))).	-10.7	0.17246	1.90735e-07	7.46108	34
+(((((....)))))....((((((....))))))	-13.1	0.17246	-1.90735e-07	7.46108	34
+.(((((((((.......)))))))))........	-13.6	123.457	12.5	13	34
Binary file vienna_rna.tar.gz has changed