|
0
|
1 <tool name="Fastqc: Fastqc QC" id="fastqc" version="0.1">
|
|
|
2 <description>using FastQC from Babraham</description>
|
|
|
3 <command interpreter="python">
|
|
|
4 rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc
|
|
|
5 #if $contaminants.dataset and str($contaminants) > ''
|
|
|
6 -c "$contaminants"
|
|
|
7 #end if
|
|
|
8 </command>
|
|
|
9 <requirements>
|
|
|
10 <requirement type="package">FastQC</requirement>
|
|
|
11 </requirements>
|
|
|
12 <inputs>
|
|
|
13 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
|
|
|
14 <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" />
|
|
|
15 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
|
|
|
16 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
|
|
|
17 </inputs>
|
|
|
18 <outputs>
|
|
|
19 <data format="html" name="html_file" label="${out_prefix}.html" />
|
|
|
20 </outputs>
|
|
|
21 <tests>
|
|
|
22 <test>
|
|
|
23 <param name="input_file" value="1000gsample.fastq" />
|
|
|
24 <param name="out_prefix" value="fastqc_out" />
|
|
|
25 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
|
|
|
26 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
|
|
|
27 </test>
|
|
|
28 </tests>
|
|
|
29 <help>
|
|
|
30
|
|
|
31 .. class:: infomark
|
|
|
32
|
|
|
33 **Purpose**
|
|
|
34
|
|
|
35 FastQC aims to provide a simple way to do some quality control checks on raw
|
|
|
36 sequence data coming from high throughput sequencing pipelines.
|
|
|
37 It provides a modular set of analyses which you can use to give a quick
|
|
|
38 impression of whether your data has any problems of
|
|
|
39 which you should be aware before doing any further analysis.
|
|
|
40
|
|
|
41 The main functions of FastQC are:
|
|
|
42
|
|
|
43 - Import of data from BAM, SAM or FastQ files (any variant)
|
|
|
44 - Providing a quick overview to tell you in which areas there may be problems
|
|
|
45 - Summary graphs and tables to quickly assess your data
|
|
|
46 - Export of results to an HTML based permanent report
|
|
|
47 - Offline operation to allow automated generation of reports without running the interactive application
|
|
|
48
|
|
|
49 **FastQC documentation**
|
|
|
50
|
|
|
51 This is a Galaxy interface to the external package FastQC_.
|
|
|
52 Specific documentation on FastQC can be found on that site.
|
|
|
53 FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
|
|
|
54
|
|
|
55 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
|
|
|
56 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
|
|
|
57
|
|
|
58 The contaminants file parameter was borrowed from the independently developed
|
|
|
59 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
|
|
|
60
|
|
|
61 -----
|
|
|
62
|
|
|
63 .. class:: infomark
|
|
|
64
|
|
|
65 **Inputs and outputs**
|
|
|
66
|
|
|
67 This wrapper will accept any fastq file as well as sam or bam as the primary file to check.
|
|
|
68 It will also take an optional file containing a list of contaminants information, in the form of
|
|
|
69 a tab-delimited file with 2 columns, name and sequence.
|
|
|
70
|
|
|
71 The tool produces a single HTML output file that contains all of the results, including the following:
|
|
|
72
|
|
|
73 - Basic Statistics
|
|
|
74 - Per base sequence quality
|
|
|
75 - Per sequence quality scores
|
|
|
76 - Per base sequence content
|
|
|
77 - Per base GC content
|
|
|
78 - Per sequence GC content
|
|
|
79 - Per base N content
|
|
|
80 - Sequence Length Distribution
|
|
|
81 - Sequence Duplication Levels
|
|
|
82 - Overrepresented sequences
|
|
|
83 - Kmer Content
|
|
|
84
|
|
|
85 All except Basic Statistics and Overrepresented sequences are plots.
|
|
|
86
|
|
|
87 </help>
|
|
|
88 </tool>
|
