<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.1">
  <description>using FastQC from Babraham</description>
  <command interpreter="python">
    rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc
#if $contaminants.dataset and str($contaminants) > ''
-c "$contaminants"
#end if
  </command>
  <requirements>
    <requirement type="package">FastQC</requirement>
  </requirements>
  <inputs>
    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" />
    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer	CAAGCAGAAGACGGCATACGA"/>
  </inputs>
  <outputs>
    <data format="html" name="html_file"  label="${out_prefix}.html" />
  </outputs>
  <tests>
    <test>
      <param name="input_file" value="1000gsample.fastq" />
      <param name="out_prefix" value="fastqc_out" />
      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
    </test>
  </tests>
  <help>

.. class:: infomark

**Purpose**

FastQC aims to provide a simple way to do some quality control checks on raw
sequence data coming from high throughput sequencing pipelines. 
It provides a modular set of analyses which you can use to give a quick
impression of whether your data has any problems of 
which you should be aware before doing any further analysis.

The main functions of FastQC are:

- Import of data from BAM, SAM or FastQ files (any variant)
- Providing a quick overview to tell you in which areas there may be problems
- Summary graphs and tables to quickly assess your data
- Export of results to an HTML based permanent report
- Offline operation to allow automated generation of reports without running the interactive application

**FastQC documentation**

This is a Galaxy interface to the external package FastQC_.
Specific documentation on FastQC can be found on that site.
FastQC incorporates the Picard-tools_ libraries for sam/bam processing.

 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
 .. _Picard-tools: http://picard.sourceforge.net/index.shtml

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.

-----

.. class:: infomark

**Inputs and outputs**

This wrapper will accept any fastq file as well as sam or bam as the primary file to check.
It will also take an optional file containing a list of contaminants information, in the form of
a tab-delimited file with 2 columns, name and sequence.

The tool produces a single HTML output file that contains all of the results, including the following:

- Basic Statistics
- Per base sequence quality
- Per sequence quality scores
- Per base sequence content
- Per base GC content
- Per sequence GC content
- Per base N content
- Sequence Length Distribution
- Sequence Duplication Levels
- Overrepresented sequences
- Kmer Content

All except Basic Statistics and Overrepresented sequences are plots.

</help>
</tool>